Incidental Mutation 'R8876:Capn5'
ID 676572
Institutional Source Beutler Lab
Gene Symbol Capn5
Ensembl Gene ENSMUSG00000035547
Gene Name calpain 5
Synonyms
MMRRC Submission 068688-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R8876 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 97770766-97827481 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 97780902 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 292 (T292A)
Ref Sequence ENSEMBL: ENSMUSP00000048183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040971] [ENSMUST00000107112]
AlphaFold O08688
Predicted Effect probably benign
Transcript: ENSMUST00000040971
AA Change: T292A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000048183
Gene: ENSMUSG00000035547
AA Change: T292A

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107112
AA Change: T292A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000102729
Gene: ENSMUSG00000035547
AA Change: T292A

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the calpain family of proteins. Unlike many members of the calpain gene family, this gene lacks a calmodulin-like domain, required for calcium binding. Mouse models for Huntington's disease displayed increased levels of the protein encoded by this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for one allele of this gene occasionally exhibit reduced viability but are usually normal. Homozygotes for another allele die as embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accs A C 2: 93,668,403 (GRCm39) L356R probably damaging Het
Acvr1 A T 2: 58,338,422 (GRCm39) D433E possibly damaging Het
Aldh3b1 A G 19: 3,971,502 (GRCm39) L122P probably damaging Het
Ap3b1 T G 13: 94,540,586 (GRCm39) N169K possibly damaging Het
Apbb2 A G 5: 66,609,000 (GRCm39) S216P probably benign Het
Arap3 T A 18: 38,130,077 (GRCm39) H28L possibly damaging Het
Arhgap44 C T 11: 64,898,896 (GRCm39) M760I possibly damaging Het
Arhgef19 G T 4: 140,975,193 (GRCm39) A304S probably benign Het
Atpaf1 T C 4: 115,645,548 (GRCm39) I139T possibly damaging Het
BC024139 G T 15: 76,010,320 (GRCm39) T62K possibly damaging Het
Bmal2 G A 6: 146,723,492 (GRCm39) G274D probably benign Het
Card19 T C 13: 49,358,814 (GRCm39) N53S possibly damaging Het
Cep97 A G 16: 55,742,467 (GRCm39) V232A possibly damaging Het
Cfap298 A G 16: 90,724,281 (GRCm39) I164T possibly damaging Het
Clca3a2 G T 3: 144,777,360 (GRCm39) T837K probably benign Het
Col8a2 G C 4: 126,204,647 (GRCm39) G219A probably damaging Het
Ctu2 T C 8: 123,206,951 (GRCm39) S365P Het
Dnah2 T C 11: 69,382,348 (GRCm39) D1254G probably damaging Het
Dscam A G 16: 96,420,828 (GRCm39) L1686S probably damaging Het
Fgr A G 4: 132,726,071 (GRCm39) probably benign Het
Frmd4a T A 2: 4,606,111 (GRCm39) S612T probably damaging Het
Gadd45gip1 T C 8: 85,560,748 (GRCm39) I121T probably damaging Het
Gapvd1 A G 2: 34,568,560 (GRCm39) V1353A possibly damaging Het
Gdf3 G A 6: 122,583,942 (GRCm39) P142S probably damaging Het
Gm19965 G A 1: 116,749,776 (GRCm39) G486R unknown Het
Gpatch2l T C 12: 86,308,405 (GRCm39) L307P probably damaging Het
Grm3 T C 5: 9,561,580 (GRCm39) K757E probably damaging Het
Inppl1 T A 7: 101,472,750 (GRCm39) H1218L possibly damaging Het
Jag2 T C 12: 112,873,257 (GRCm39) I1055V probably benign Het
Krtap9-5 G T 11: 99,840,340 (GRCm39) C347F unknown Het
Magi2 T A 5: 20,856,190 (GRCm39) Y1050* probably null Het
Myrf A G 19: 10,206,378 (GRCm39) probably benign Het
Ntpcr T G 8: 126,464,785 (GRCm39) probably benign Het
Or13a19 T C 7: 139,902,716 (GRCm39) Y35H probably damaging Het
Or1p1b C T 11: 74,130,846 (GRCm39) T152I probably damaging Het
Or2y1c T C 11: 49,361,386 (GRCm39) M136T probably damaging Het
Palmd T G 3: 116,720,899 (GRCm39) D145A probably damaging Het
Pdcd1 A G 1: 93,980,155 (GRCm39) S21P probably benign Het
Pkn1 T C 8: 84,398,879 (GRCm39) T696A possibly damaging Het
Pnpt1 T A 11: 29,096,769 (GRCm39) probably benign Het
Sbf2 T A 7: 110,049,146 (GRCm39) I273F probably damaging Het
Skic3 T G 13: 76,323,403 (GRCm39) D1382E probably benign Het
Slc16a4 A T 3: 107,208,101 (GRCm39) N204Y probably benign Het
Slc38a1 T C 15: 96,514,091 (GRCm39) I44V possibly damaging Het
Smpdl3a T C 10: 57,685,166 (GRCm39) V312A probably damaging Het
Ston1 A G 17: 88,942,600 (GRCm39) Y2C probably benign Het
Syde1 A T 10: 78,425,325 (GRCm39) Y229N probably damaging Het
Ttc6 T A 12: 57,784,489 (GRCm39) C1853S possibly damaging Het
Ttn A G 2: 76,609,249 (GRCm39) I17650T possibly damaging Het
Upf1 T C 8: 70,796,918 (GRCm39) E105G possibly damaging Het
Wrn A G 8: 33,814,422 (GRCm39) W341R probably benign Het
Xndc1 C T 7: 101,729,754 (GRCm39) P267L probably benign Het
Zbtb26 T C 2: 37,326,896 (GRCm39) T47A probably benign Het
Zc3h10 A T 10: 128,380,163 (GRCm39) V398E probably damaging Het
Zfp652 G T 11: 95,639,921 (GRCm39) probably benign Het
Other mutations in Capn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Capn5 APN 7 97,784,971 (GRCm39) missense probably damaging 1.00
IGL01311:Capn5 APN 7 97,811,130 (GRCm39) missense probably damaging 1.00
IGL01768:Capn5 APN 7 97,774,480 (GRCm39) missense probably damaging 1.00
IGL01926:Capn5 APN 7 97,777,679 (GRCm39) critical splice donor site probably null
IGL02076:Capn5 APN 7 97,780,950 (GRCm39) nonsense probably null
IGL02505:Capn5 APN 7 97,780,403 (GRCm39) missense possibly damaging 0.85
BB007:Capn5 UTSW 7 97,773,085 (GRCm39) missense probably benign
BB017:Capn5 UTSW 7 97,773,085 (GRCm39) missense probably benign
PIT4466001:Capn5 UTSW 7 97,773,195 (GRCm39) missense probably benign 0.00
R0178:Capn5 UTSW 7 97,782,098 (GRCm39) missense probably damaging 1.00
R0518:Capn5 UTSW 7 97,782,089 (GRCm39) missense probably damaging 1.00
R0521:Capn5 UTSW 7 97,782,089 (GRCm39) missense probably damaging 1.00
R1459:Capn5 UTSW 7 97,781,049 (GRCm39) missense possibly damaging 0.84
R2005:Capn5 UTSW 7 97,778,570 (GRCm39) missense probably benign
R2258:Capn5 UTSW 7 97,785,082 (GRCm39) missense probably damaging 0.99
R2327:Capn5 UTSW 7 97,775,574 (GRCm39) missense probably benign 0.07
R3797:Capn5 UTSW 7 97,775,036 (GRCm39) missense probably null 0.77
R4032:Capn5 UTSW 7 97,778,453 (GRCm39) missense probably damaging 0.96
R4620:Capn5 UTSW 7 97,778,578 (GRCm39) missense probably damaging 0.98
R4717:Capn5 UTSW 7 97,773,126 (GRCm39) missense probably benign 0.02
R4777:Capn5 UTSW 7 97,780,925 (GRCm39) missense probably damaging 1.00
R4823:Capn5 UTSW 7 97,775,648 (GRCm39) missense probably damaging 1.00
R4841:Capn5 UTSW 7 97,780,879 (GRCm39) splice site probably null
R4965:Capn5 UTSW 7 97,775,624 (GRCm39) missense probably damaging 0.99
R5568:Capn5 UTSW 7 97,775,137 (GRCm39) missense probably damaging 1.00
R5732:Capn5 UTSW 7 97,778,593 (GRCm39) missense possibly damaging 0.95
R5792:Capn5 UTSW 7 97,780,402 (GRCm39) missense probably benign 0.09
R6892:Capn5 UTSW 7 97,785,148 (GRCm39) missense probably damaging 1.00
R6923:Capn5 UTSW 7 97,778,461 (GRCm39) missense probably damaging 1.00
R7095:Capn5 UTSW 7 97,775,038 (GRCm39) missense probably benign 0.10
R7391:Capn5 UTSW 7 97,780,426 (GRCm39) missense probably benign 0.02
R7553:Capn5 UTSW 7 97,773,231 (GRCm39) missense probably damaging 1.00
R7930:Capn5 UTSW 7 97,773,085 (GRCm39) missense probably benign
R8914:Capn5 UTSW 7 97,784,997 (GRCm39) missense probably damaging 0.99
R9012:Capn5 UTSW 7 97,814,050 (GRCm39) start gained probably benign
R9087:Capn5 UTSW 7 97,775,531 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTCCTTGATGAACCTACCC -3'
(R):5'- TAGATCCCAGTGTGACCCTC -3'

Sequencing Primer
(F):5'- CCCCAAGCACCACACTTAC -3'
(R):5'- AGTGTGACCCTCCTGTCTGTG -3'
Posted On 2021-07-15