Mutagenetix > Incidental Mutation

Incidental Mutation 'R8876:Upf1'

676578

Institutional Source

Beutler Lab

Gene Symbol

Upf1

Ensembl Gene

ENSMUSG00000058301

Gene Name

UPF1 regulator of nonsense transcripts homolog (yeast)

Synonyms

B430202H16Rik, PNORF-1, Rent1

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.970) question?

Stock #

R8876 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70331525-70353278 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70344268 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 105 (E105G)

Ref Sequence

ENSEMBL: ENSMUSP00000075089 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000215817]

AlphaFold

Q9EPU0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075666
AA Change: E105G

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301
AA Change: E105G

Domain	Start	End	E-Value	Type
low complexity region	47	67	N/A	INTRINSIC
low complexity region	101	110	N/A	INTRINSIC
Pfam:UPF1_Zn_bind	116	267	4.1e-78	PFAM
Pfam:ResIII	475	617	1.3e-6	PFAM
Pfam:AAA_11	476	600	4.5e-24	PFAM
Pfam:AAA_30	476	688	5.6e-13	PFAM
Pfam:AAA_19	483	559	3.8e-16	PFAM
Pfam:AAA_11	576	679	7.7e-30	PFAM
Pfam:AAA_12	686	883	3.3e-64	PFAM
low complexity region	995	1001	N/A	INTRINSIC
low complexity region	1013	1028	N/A	INTRINSIC
low complexity region	1066	1081	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000215817
AA Change: E105G

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)

Meta Mutation Damage Score

0.0945

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110004E09Rik	A	G	16: 90,927,393	I164T	possibly damaging	Het
Accs	A	C	2: 93,838,058	L356R	probably damaging	Het
Acvr1	A	T	2: 58,448,410	D433E	possibly damaging	Het
Aldh3b1	A	G	19: 3,921,502	L122P	probably damaging	Het
Ap3b1	T	G	13: 94,404,078	N169K	possibly damaging	Het
Apbb2	A	G	5: 66,451,657	S216P	probably benign	Het
Arap3	T	A	18: 37,997,024	H28L	possibly damaging	Het
Arhgap44	C	T	11: 65,008,070	M760I	possibly damaging	Het
Arhgef19	G	T	4: 141,247,882	A304S	probably benign	Het
Arntl2	G	A	6: 146,821,994	G274D	probably benign	Het
Atpaf1	T	C	4: 115,788,351	I139T	possibly damaging	Het
BC024139	G	T	15: 76,126,120	T62K	possibly damaging	Het
Capn5	T	C	7: 98,131,695	T292A	probably benign	Het
Card19	T	C	13: 49,205,338	N53S	possibly damaging	Het
Cep97	A	G	16: 55,922,104	V232A	possibly damaging	Het
Clca2	G	T	3: 145,071,599	T837K	probably benign	Het
Col8a2	G	C	4: 126,310,854	G219A	probably damaging	Het
Ctu2	T	C	8: 122,480,212	S365P		Het
Dnah2	T	C	11: 69,491,522	D1254G	probably damaging	Het
Dscam	A	G	16: 96,619,628	L1686S	probably damaging	Het
Fgr	A	G	4: 132,998,760		probably benign	Het
Frmd4a	T	A	2: 4,601,300	S612T	probably damaging	Het
Gadd45gip1	T	C	8: 84,834,119	I121T	probably damaging	Het
Gapvd1	A	G	2: 34,678,548	V1353A	possibly damaging	Het
Gdf3	G	A	6: 122,606,983	P142S	probably damaging	Het
Gm19965	G	A	1: 116,822,046	G486R	unknown	Het
Gpatch2l	T	C	12: 86,261,631	L307P	probably damaging	Het
Grm3	T	C	5: 9,511,580	K757E	probably damaging	Het
Inppl1	T	A	7: 101,823,543	H1218L	possibly damaging	Het
Jag2	T	C	12: 112,909,637	I1055V	probably benign	Het
Krtap9-5	G	T	11: 99,949,514	C347F	unknown	Het
Magi2	T	A	5: 20,651,192	Y1050*	probably null	Het
Myrf	A	G	19: 10,229,014		probably benign	Het
Ntpcr	T	G	8: 125,738,046		probably benign	Het
Olfr1386	T	C	11: 49,470,559	M136T	probably damaging	Het
Olfr404-ps1	C	T	11: 74,240,020	T152I	probably damaging	Het
Olfr525	T	C	7: 140,322,803	Y35H	probably damaging	Het
Palmd	T	G	3: 116,927,250	D145A	probably damaging	Het
Pdcd1	A	G	1: 94,052,430	S21P	probably benign	Het
Pkn1	T	C	8: 83,672,250	T696A	possibly damaging	Het
Pnpt1	T	A	11: 29,146,769		probably benign	Het
Sbf2	T	A	7: 110,449,939	I273F	probably damaging	Het
Slc16a4	A	T	3: 107,300,785	N204Y	probably benign	Het
Slc38a1	T	C	15: 96,616,210	I44V	possibly damaging	Het
Smpdl3a	T	C	10: 57,809,070	V312A	probably damaging	Het
Ston1	A	G	17: 88,635,172	Y2C	probably benign	Het
Syde1	A	T	10: 78,589,491	Y229N	probably damaging	Het
Ttc37	T	G	13: 76,175,284	D1382E	probably benign	Het
Ttc6	T	A	12: 57,737,703	C1853S	possibly damaging	Het
Ttn	A	G	2: 76,778,905	I17650T	possibly damaging	Het
Wrn	A	G	8: 33,324,394	W341R	probably benign	Het
Xndc1	C	T	7: 102,080,547	P267L	probably benign	Het
Zbtb26	T	C	2: 37,436,884	T47A	probably benign	Het
Zc3h10	A	T	10: 128,544,294	V398E	probably damaging	Het
Zfp652	G	T	11: 95,749,095		probably benign	Het

Other mutations in Upf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01113:Upf1	APN	8	70338284	missense	probably benign
IGL01890:Upf1	APN	8	70334230	missense	possibly damaging	0.94
IGL02534:Upf1	APN	8	70335652	critical splice donor site	probably null
IGL03142:Upf1	APN	8	70333327	missense	probably benign	0.04
IGL03151:Upf1	APN	8	70335387	missense	probably damaging	0.98
Nanosphere	UTSW	8	70344262	missense	probably benign	0.01
Particulate	UTSW	8	70337025	missense	probably damaging	0.96
R0270:Upf1	UTSW	8	70335645	splice site	probably benign
R0477:Upf1	UTSW	8	70334080	missense	probably benign
R0755:Upf1	UTSW	8	70334129	missense	probably benign	0.01
R1018:Upf1	UTSW	8	70338906	missense	possibly damaging	0.85
R1067:Upf1	UTSW	8	70338403	missense	probably damaging	0.98
R1445:Upf1	UTSW	8	70341524	missense	probably benign	0.00
R1458:Upf1	UTSW	8	70344254	missense	probably benign	0.00
R1511:Upf1	UTSW	8	70338505	missense	probably damaging	0.99
R1552:Upf1	UTSW	8	70333059	nonsense	probably null
R1560:Upf1	UTSW	8	70338442	missense	probably damaging	1.00
R1562:Upf1	UTSW	8	70343367	nonsense	probably null
R2082:Upf1	UTSW	8	70341572	missense	probably damaging	1.00
R2143:Upf1	UTSW	8	70339354	missense	probably null	1.00
R2423:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R2425:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3031:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3032:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3123:Upf1	UTSW	8	70337483	splice site	probably benign
R3508:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3747:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3748:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3750:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3754:Upf1	UTSW	8	70339814	missense	probably benign	0.30
R3964:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3965:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4152:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4505:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4506:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4838:Upf1	UTSW	8	70339368	missense	probably benign	0.03
R5001:Upf1	UTSW	8	70334700	missense	probably damaging	1.00
R5715:Upf1	UTSW	8	70352978	missense	probably damaging	0.96
R5748:Upf1	UTSW	8	70338517	missense	probably damaging	1.00
R5856:Upf1	UTSW	8	70334762	critical splice acceptor site	probably null
R5930:Upf1	UTSW	8	70344262	missense	probably benign	0.01
R6010:Upf1	UTSW	8	70337025	missense	probably damaging	0.96
R6056:Upf1	UTSW	8	70333037	missense	probably damaging	0.98
R6870:Upf1	UTSW	8	70341561	missense	probably benign	0.11
R7205:Upf1	UTSW	8	70340045	missense	possibly damaging	0.94
R7385:Upf1	UTSW	8	70340618	missense	probably damaging	1.00
R7464:Upf1	UTSW	8	70333423	missense	probably benign
R7759:Upf1	UTSW	8	70334080	missense	probably benign
R7783:Upf1	UTSW	8	70352858	missense	probably benign	0.11
R8079:Upf1	UTSW	8	70338884	critical splice donor site	probably null
R8192:Upf1	UTSW	8	70340644	missense	probably benign	0.03
R8544:Upf1	UTSW	8	70337052	missense	probably damaging	1.00
R8738:Upf1	UTSW	8	70333322	missense	probably benign	0.01
R8738:Upf1	UTSW	8	70333323	missense	probably benign	0.06
R8826:Upf1	UTSW	8	70338280	missense	probably benign
R8906:Upf1	UTSW	8	70334165	nonsense	probably null
R8911:Upf1	UTSW	8	70338437	missense	possibly damaging	0.53
R9163:Upf1	UTSW	8	70340024	missense	probably benign
R9425:Upf1	UTSW	8	70339353	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- CCCTGATGGAGCTGATTTAGTC -3'
(R):5'- AGCATAGACCTCAGGAGTGG -3'

Sequencing Primer
(F):5'- GATTTAGTCAGGATCCATGCCCTG -3'
(R):5'- TCAGGAGTGGGGCCTCTG -3'

Posted On

2021-07-15