Incidental Mutation 'R0732:Fbxo8'
ID67658
Institutional Source Beutler Lab
Gene Symbol Fbxo8
Ensembl Gene ENSMUSG00000038206
Gene NameF-box protein 8
SynonymsFbx8
MMRRC Submission 038913-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0732 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location56551090-56593939 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56591529 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 289 (I289N)
Ref Sequence ENSEMBL: ENSMUSP00000037544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040218] [ENSMUST00000110322]
Predicted Effect probably damaging
Transcript: ENSMUST00000040218
AA Change: I289N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037544
Gene: ENSMUSG00000038206
AA Change: I289N

DomainStartEndE-ValueType
Pfam:F-box-like 71 114 1.3e-8 PFAM
Sec7 132 316 2.52e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110322
SMART Domains Protein: ENSMUSP00000105951
Gene: ENSMUSG00000038206

DomainStartEndE-ValueType
Pfam:F-box-like 71 114 1.2e-9 PFAM
Blast:Sec7 132 159 8e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211294
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It contains a C-terminal amino acid sequence that bears a significant similarity with a portion of yeast Sec7p, a critical regulator of vesicular protein transport. This human protein may interact with ADP-ribosylation factor(s)(ARFs) and exhibit ARF-GEF (guanine nucleotide exchange factor) activity. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,546,448 Y1175C probably damaging Het
Acsm3 T C 7: 119,773,834 S187P probably benign Het
Adam28 T C 14: 68,637,347 I294V probably benign Het
Adgrv1 T C 13: 81,503,004 I3057M possibly damaging Het
Aff4 T C 11: 53,375,596 V304A probably benign Het
Akr1b10 T C 6: 34,390,109 Y108H probably benign Het
Ankib1 T C 5: 3,713,163 N522S possibly damaging Het
Ano1 T A 7: 144,619,488 probably null Het
Antxr2 G T 5: 97,960,708 probably null Het
Arc G A 15: 74,671,195 T393I probably damaging Het
Arhgef33 A G 17: 80,381,354 D5G possibly damaging Het
Atf2 A T 2: 73,845,500 M169K possibly damaging Het
BC005624 T A 2: 30,973,937 T215S possibly damaging Het
BC048403 T C 10: 121,750,947 V253A possibly damaging Het
Bmp8b G A 4: 123,105,406 G19D unknown Het
Cacna1d T C 14: 30,042,920 N1987S probably damaging Het
Camta1 T A 4: 151,586,484 probably null Het
Catsperg2 C T 7: 29,700,696 G316D probably damaging Het
Cbs G T 17: 31,625,029 N209K probably benign Het
Ccdc122 T A 14: 77,091,759 M84K probably damaging Het
Cd5 C T 19: 10,723,285 C285Y probably damaging Het
Chpf2 T C 5: 24,590,421 M1T probably null Het
Coch T A 12: 51,595,372 D42E probably damaging Het
Crip2 C T 12: 113,140,558 probably benign Het
Crlf2 G C 5: 109,557,138 P67R probably damaging Het
Cxcl16 G T 11: 70,455,408 P233H probably damaging Het
Cyfip1 T C 7: 55,886,781 I319T probably damaging Het
Ddhd2 T C 8: 25,741,321 Q364R probably damaging Het
Ephx2 A G 14: 66,086,963 probably null Het
Exoc6b C A 6: 84,855,522 V397L probably damaging Het
Fam83b T A 9: 76,492,928 K298* probably null Het
Fkbp9 T A 6: 56,878,104 M536K probably benign Het
Flot1 C T 17: 35,825,524 R190W possibly damaging Het
Gbp2b T A 3: 142,606,978 V374E probably benign Het
Gm884 T C 11: 103,619,838 T435A unknown Het
Gna15 T A 10: 81,512,556 S114C probably damaging Het
Gstt4 T A 10: 75,817,321 T136S probably benign Het
Hcn3 C T 3: 89,148,786 V524M probably damaging Het
Kctd16 A T 18: 40,258,563 D68V probably damaging Het
Krt90 G T 15: 101,560,425 F227L possibly damaging Het
Maip1 A G 1: 57,411,835 Y212C probably damaging Het
Mamdc2 C T 19: 23,378,869 D72N probably damaging Het
Marveld3 A T 8: 109,948,483 Y234N probably damaging Het
Mas1 A G 17: 12,841,747 I263T probably benign Het
Matk T A 10: 81,258,306 probably null Het
Mrgpre T A 7: 143,781,566 I67F possibly damaging Het
Mthfd1 T A 12: 76,294,174 I449N probably damaging Het
Nacc1 C T 8: 84,676,201 R321Q probably damaging Het
Neb T C 2: 52,258,681 D2618G probably damaging Het
Neb T C 2: 52,291,268 Y1109C probably damaging Het
Nell1 T G 7: 50,856,387 W781G probably damaging Het
Olfr1037 A C 2: 86,085,584 S64R probably benign Het
Olfr1269 A G 2: 90,119,322 V92A probably benign Het
Olfr1279 T A 2: 111,306,980 Y258* probably null Het
Olfr281 T C 15: 98,457,078 L256S possibly damaging Het
Olfr424 A T 1: 174,137,415 I224F possibly damaging Het
Olfr497 C A 7: 108,422,577 A2D probably benign Het
Olfr544 T C 7: 102,484,443 I226V probably benign Het
Olfr646 T C 7: 104,106,294 L5P probably damaging Het
Pcdh7 C A 5: 57,721,315 D737E probably damaging Het
Pdss1 T G 2: 22,901,312 M55R probably benign Het
Pex6 C T 17: 46,724,700 R889W probably damaging Het
Pigl T A 11: 62,458,481 C8S possibly damaging Het
Plekha7 A T 7: 116,145,237 M585K probably damaging Het
Ppp1r1a C T 15: 103,533,087 M66I possibly damaging Het
Ptcd3 A T 6: 71,881,171 probably benign Het
Rhov A T 2: 119,271,014 V37E probably damaging Het
Rnf213 A T 11: 119,441,068 M2368L probably damaging Het
Skida1 T C 2: 18,046,157 probably benign Het
Slc25a28 T C 19: 43,666,953 D161G probably benign Het
Smc6 T C 12: 11,290,817 V490A probably damaging Het
Sohlh2 T A 3: 55,190,373 probably null Het
Stk31 A G 6: 49,417,495 T264A probably benign Het
Syngap1 T A 17: 26,954,988 S190R possibly damaging Het
Tacr1 T A 6: 82,552,901 V200E probably damaging Het
Tbrg4 C T 11: 6,620,812 R220H probably benign Het
Tcf20 A G 15: 82,852,303 L1649P probably benign Het
Tcirg1 A T 19: 3,897,866 L523Q possibly damaging Het
Tinag T A 9: 77,001,654 K335M possibly damaging Het
Tkt T G 14: 30,571,140 probably null Het
Tnpo1 C T 13: 98,863,812 R349H probably damaging Het
Trim26 T A 17: 36,852,618 S230R possibly damaging Het
Trim8 T A 19: 46,514,739 probably null Het
Trp53bp1 T C 2: 121,248,264 R326G probably null Het
Ugt2a2 A T 5: 87,460,639 I613N probably damaging Het
Vmn1r32 T C 6: 66,553,706 I29V probably benign Het
Wnt5b C T 6: 119,446,582 W27* probably null Het
Other mutations in Fbxo8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Fbxo8 APN 8 56588023 missense probably benign 0.20
IGL02699:Fbxo8 APN 8 56590188 missense possibly damaging 0.94
R0240:Fbxo8 UTSW 8 56590261 intron probably benign
R0295:Fbxo8 UTSW 8 56590074 missense probably benign 0.01
R0310:Fbxo8 UTSW 8 56590097 missense probably damaging 1.00
R3895:Fbxo8 UTSW 8 56591521 missense probably damaging 1.00
R4258:Fbxo8 UTSW 8 56588041 missense probably benign 0.05
R5162:Fbxo8 UTSW 8 56569319 missense probably damaging 1.00
R5687:Fbxo8 UTSW 8 56591517 missense probably damaging 1.00
R6087:Fbxo8 UTSW 8 56569318 missense probably damaging 1.00
R6297:Fbxo8 UTSW 8 56569288 missense probably damaging 1.00
R7422:Fbxo8 UTSW 8 56569282 critical splice acceptor site probably null
R7689:Fbxo8 UTSW 8 56588085 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GTCACCTGGAAGCAAAGCCTAGAC -3'
(R):5'- ATGCAACCCTGCTGCCACTAAG -3'

Sequencing Primer
(F):5'- CTAGACCCACAGGGTGGATTG -3'
(R):5'- ACTAAGTCTGTCCCTGGGTAGC -3'
Posted On2013-09-03