Incidental Mutation 'R8876:Jag2'
ID 676593
Institutional Source Beutler Lab
Gene Symbol Jag2
Ensembl Gene ENSMUSG00000002799
Gene Name jagged 2
Synonyms Serh, D12Ggc2e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8876 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 112907819-112929776 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 112909637 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1055 (I1055V)
Ref Sequence ENSEMBL: ENSMUSP00000075224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075827]
AlphaFold Q9QYE5
Predicted Effect probably benign
Transcript: ENSMUST00000075827
AA Change: I1055V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000075224
Gene: ENSMUSG00000002799
AA Change: I1055V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:MNNL 26 105 4.2e-31 PFAM
low complexity region 108 123 N/A INTRINSIC
DSL 178 240 1.48e-36 SMART
EGF_like 244 274 7.23e1 SMART
EGF 275 305 4.56e0 SMART
EGF_CA 307 345 8.5e-9 SMART
EGF 350 383 4e-5 SMART
EGF_CA 385 421 5.39e-11 SMART
EGF_CA 423 459 3.51e-10 SMART
EGF_CA 461 496 1.01e-10 SMART
EGF_CA 498 534 1.17e-6 SMART
EGF_CA 536 572 6.35e-8 SMART
EGF 588 634 7.53e-1 SMART
EGF_CA 636 672 2.89e-11 SMART
EGF 677 710 3.68e-4 SMART
EGF 715 748 1.32e-5 SMART
EGF 754 787 1.34e-6 SMART
EGF_CA 789 825 2.58e-8 SMART
EGF_CA 827 863 7.23e-12 SMART
VWC 872 949 1.3e-1 SMART
low complexity region 1002 1035 N/A INTRINSIC
transmembrane domain 1085 1107 N/A INTRINSIC
low complexity region 1109 1119 N/A INTRINSIC
low complexity region 1170 1199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223140
Meta Mutation Damage Score 0.0663 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Notch signaling pathway is an intercellular signaling mechanism that is essential for proper embryonic development. Members of the Notch gene family encode transmembrane receptors that are critical for various cell fate decisions. The protein encoded by this gene is one of several ligands that activate Notch and related receptors. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation die perinatally with craniofacial defects, fused digits, and increased numbers of sensory hair cells in the cochlea. Homozygotes for a spontaneous mutation exhibit fused digits and sometimes tail kinks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik A G 16: 90,927,393 I164T possibly damaging Het
Accs A C 2: 93,838,058 L356R probably damaging Het
Acvr1 A T 2: 58,448,410 D433E possibly damaging Het
Aldh3b1 A G 19: 3,921,502 L122P probably damaging Het
Ap3b1 T G 13: 94,404,078 N169K possibly damaging Het
Apbb2 A G 5: 66,451,657 S216P probably benign Het
Arap3 T A 18: 37,997,024 H28L possibly damaging Het
Arhgap44 C T 11: 65,008,070 M760I possibly damaging Het
Arhgef19 G T 4: 141,247,882 A304S probably benign Het
Arntl2 G A 6: 146,821,994 G274D probably benign Het
Atpaf1 T C 4: 115,788,351 I139T possibly damaging Het
BC024139 G T 15: 76,126,120 T62K possibly damaging Het
Capn5 T C 7: 98,131,695 T292A probably benign Het
Card19 T C 13: 49,205,338 N53S possibly damaging Het
Cep97 A G 16: 55,922,104 V232A possibly damaging Het
Clca2 G T 3: 145,071,599 T837K probably benign Het
Col8a2 G C 4: 126,310,854 G219A probably damaging Het
Ctu2 T C 8: 122,480,212 S365P Het
Dnah2 T C 11: 69,491,522 D1254G probably damaging Het
Dscam A G 16: 96,619,628 L1686S probably damaging Het
Fgr A G 4: 132,998,760 probably benign Het
Frmd4a T A 2: 4,601,300 S612T probably damaging Het
Gadd45gip1 T C 8: 84,834,119 I121T probably damaging Het
Gapvd1 A G 2: 34,678,548 V1353A possibly damaging Het
Gdf3 G A 6: 122,606,983 P142S probably damaging Het
Gm19965 G A 1: 116,822,046 G486R unknown Het
Gpatch2l T C 12: 86,261,631 L307P probably damaging Het
Grm3 T C 5: 9,511,580 K757E probably damaging Het
Inppl1 T A 7: 101,823,543 H1218L possibly damaging Het
Krtap9-5 G T 11: 99,949,514 C347F unknown Het
Magi2 T A 5: 20,651,192 Y1050* probably null Het
Myrf A G 19: 10,229,014 probably benign Het
Ntpcr T G 8: 125,738,046 probably benign Het
Olfr1386 T C 11: 49,470,559 M136T probably damaging Het
Olfr404-ps1 C T 11: 74,240,020 T152I probably damaging Het
Olfr525 T C 7: 140,322,803 Y35H probably damaging Het
Palmd T G 3: 116,927,250 D145A probably damaging Het
Pdcd1 A G 1: 94,052,430 S21P probably benign Het
Pkn1 T C 8: 83,672,250 T696A possibly damaging Het
Pnpt1 T A 11: 29,146,769 probably benign Het
Sbf2 T A 7: 110,449,939 I273F probably damaging Het
Slc16a4 A T 3: 107,300,785 N204Y probably benign Het
Slc38a1 T C 15: 96,616,210 I44V possibly damaging Het
Smpdl3a T C 10: 57,809,070 V312A probably damaging Het
Ston1 A G 17: 88,635,172 Y2C probably benign Het
Syde1 A T 10: 78,589,491 Y229N probably damaging Het
Ttc37 T G 13: 76,175,284 D1382E probably benign Het
Ttc6 T A 12: 57,737,703 C1853S possibly damaging Het
Ttn A G 2: 76,778,905 I17650T possibly damaging Het
Upf1 T C 8: 70,344,268 E105G possibly damaging Het
Wrn A G 8: 33,324,394 W341R probably benign Het
Xndc1 C T 7: 102,080,547 P267L probably benign Het
Zbtb26 T C 2: 37,436,884 T47A probably benign Het
Zc3h10 A T 10: 128,544,294 V398E probably damaging Het
Zfp652 G T 11: 95,749,095 probably benign Het
Other mutations in Jag2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Jag2 APN 12 112912718 missense probably benign 0.20
IGL00954:Jag2 APN 12 112920406 missense possibly damaging 0.50
IGL01532:Jag2 APN 12 112914363 missense probably damaging 0.98
IGL01646:Jag2 APN 12 112916349 missense possibly damaging 0.65
IGL02243:Jag2 APN 12 112916345 missense possibly damaging 0.94
IGL02447:Jag2 APN 12 112912612 missense probably damaging 1.00
IGL02458:Jag2 APN 12 112915993 missense probably damaging 0.98
IGL02516:Jag2 APN 12 112910566 missense probably damaging 1.00
IGL02574:Jag2 APN 12 112915511 missense probably benign 0.32
IGL02629:Jag2 APN 12 112914514 splice site probably benign
IGL02873:Jag2 APN 12 112910502 missense probably benign 0.00
IGL03087:Jag2 APN 12 112913948 missense possibly damaging 0.60
Jaguarundi UTSW 12 112915469 critical splice donor site probably null
R0068:Jag2 UTSW 12 112915193 splice site probably benign
R0310:Jag2 UTSW 12 112913377 unclassified probably benign
R0963:Jag2 UTSW 12 112915314 missense probably damaging 1.00
R1188:Jag2 UTSW 12 112920121 nonsense probably null
R1256:Jag2 UTSW 12 112914419 missense possibly damaging 0.50
R1298:Jag2 UTSW 12 112916319 unclassified probably benign
R1317:Jag2 UTSW 12 112914501 missense probably benign
R2079:Jag2 UTSW 12 112920377 missense probably damaging 1.00
R2345:Jag2 UTSW 12 112909064 missense probably damaging 1.00
R4654:Jag2 UTSW 12 112913646 missense probably benign 0.13
R4782:Jag2 UTSW 12 112914249 missense probably benign
R4798:Jag2 UTSW 12 112916632 missense probably benign 0.01
R5242:Jag2 UTSW 12 112916866 missense probably damaging 0.97
R5350:Jag2 UTSW 12 112908922 missense possibly damaging 0.77
R5364:Jag2 UTSW 12 112910534 missense probably damaging 1.00
R6129:Jag2 UTSW 12 112920349 nonsense probably null
R6362:Jag2 UTSW 12 112920122 missense probably damaging 0.97
R6376:Jag2 UTSW 12 112909329 missense probably benign 0.00
R6819:Jag2 UTSW 12 112910541 missense probably damaging 1.00
R6844:Jag2 UTSW 12 112916714 missense probably damaging 1.00
R6968:Jag2 UTSW 12 112914258 missense probably benign 0.10
R7514:Jag2 UTSW 12 112929052 missense probably benign 0.19
R7663:Jag2 UTSW 12 112913666 missense probably damaging 1.00
R7730:Jag2 UTSW 12 112922041 missense probably damaging 1.00
R7754:Jag2 UTSW 12 112915469 critical splice donor site probably null
R7828:Jag2 UTSW 12 112913180 missense probably benign 0.19
R7874:Jag2 UTSW 12 112915946 missense probably damaging 0.99
R8075:Jag2 UTSW 12 112915274 missense probably benign 0.05
R8845:Jag2 UTSW 12 112920094 missense probably damaging 1.00
R9117:Jag2 UTSW 12 112913659 nonsense probably null
R9400:Jag2 UTSW 12 112911988 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAACATCCTGCGTCCACATGG -3'
(R):5'- AGGACCCGATCAGAGTTTGG -3'

Sequencing Primer
(F):5'- CAAGCAGGGACTCTTCTGGTTTC -3'
(R):5'- CAGAGTTTGGGCAGTGGCTATAAC -3'
Posted On 2021-07-15