Incidental Mutation 'R8876:Ap3b1'
ID 676596
Institutional Source Beutler Lab
Gene Symbol Ap3b1
Ensembl Gene ENSMUSG00000021686
Gene Name adaptor-related protein complex 3, beta 1 subunit
Synonyms recombination induced mutation 2, rim2, Hps2, beta3A, AP-3
MMRRC Submission
Accession Numbers

Ap3b1: Ncbi RefSeq: NM_009680; MGI: 1333879;
Essential gene? Possibly non essential (E-score: 0.441) question?
Stock # R8876 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 94358960-94566317 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 94404078 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 169 (N169K)
Ref Sequence ENSEMBL: ENSMUSP00000022196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022196]
AlphaFold Q9Z1T1
Predicted Effect possibly damaging
Transcript: ENSMUST00000022196
AA Change: N169K

PolyPhen 2 Score 0.512 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686
AA Change: N169K

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Pfam:Adaptin_N 39 586 1.2e-170 PFAM
Pfam:SEEEED 672 812 1.3e-27 PFAM
AP3B1_C 822 969 1.58e-78 SMART
Blast:B2 993 1103 2e-27 BLAST
Meta Mutation Damage Score 0.1702 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]
Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik A G 16: 90,927,393 I164T possibly damaging Het
Accs A C 2: 93,838,058 L356R probably damaging Het
Acvr1 A T 2: 58,448,410 D433E possibly damaging Het
Aldh3b1 A G 19: 3,921,502 L122P probably damaging Het
Apbb2 A G 5: 66,451,657 S216P probably benign Het
Arap3 T A 18: 37,997,024 H28L possibly damaging Het
Arhgap44 C T 11: 65,008,070 M760I possibly damaging Het
Arhgef19 G T 4: 141,247,882 A304S probably benign Het
Arntl2 G A 6: 146,821,994 G274D probably benign Het
Atpaf1 T C 4: 115,788,351 I139T possibly damaging Het
BC024139 G T 15: 76,126,120 T62K possibly damaging Het
Capn5 T C 7: 98,131,695 T292A probably benign Het
Card19 T C 13: 49,205,338 N53S possibly damaging Het
Cep97 A G 16: 55,922,104 V232A possibly damaging Het
Clca2 G T 3: 145,071,599 T837K probably benign Het
Col8a2 G C 4: 126,310,854 G219A probably damaging Het
Ctu2 T C 8: 122,480,212 S365P Het
Dnah2 T C 11: 69,491,522 D1254G probably damaging Het
Dscam A G 16: 96,619,628 L1686S probably damaging Het
Fgr A G 4: 132,998,760 probably benign Het
Frmd4a T A 2: 4,601,300 S612T probably damaging Het
Gadd45gip1 T C 8: 84,834,119 I121T probably damaging Het
Gapvd1 A G 2: 34,678,548 V1353A possibly damaging Het
Gdf3 G A 6: 122,606,983 P142S probably damaging Het
Gm19965 G A 1: 116,822,046 G486R unknown Het
Gpatch2l T C 12: 86,261,631 L307P probably damaging Het
Grm3 T C 5: 9,511,580 K757E probably damaging Het
Inppl1 T A 7: 101,823,543 H1218L possibly damaging Het
Jag2 T C 12: 112,909,637 I1055V probably benign Het
Krtap9-5 G T 11: 99,949,514 C347F unknown Het
Magi2 T A 5: 20,651,192 Y1050* probably null Het
Myrf A G 19: 10,229,014 probably benign Het
Ntpcr T G 8: 125,738,046 probably benign Het
Olfr1386 T C 11: 49,470,559 M136T probably damaging Het
Olfr404-ps1 C T 11: 74,240,020 T152I probably damaging Het
Olfr525 T C 7: 140,322,803 Y35H probably damaging Het
Palmd T G 3: 116,927,250 D145A probably damaging Het
Pdcd1 A G 1: 94,052,430 S21P probably benign Het
Pkn1 T C 8: 83,672,250 T696A possibly damaging Het
Pnpt1 T A 11: 29,146,769 probably benign Het
Sbf2 T A 7: 110,449,939 I273F probably damaging Het
Slc16a4 A T 3: 107,300,785 N204Y probably benign Het
Slc38a1 T C 15: 96,616,210 I44V possibly damaging Het
Smpdl3a T C 10: 57,809,070 V312A probably damaging Het
Ston1 A G 17: 88,635,172 Y2C probably benign Het
Syde1 A T 10: 78,589,491 Y229N probably damaging Het
Ttc37 T G 13: 76,175,284 D1382E probably benign Het
Ttc6 T A 12: 57,737,703 C1853S possibly damaging Het
Ttn A G 2: 76,778,905 I17650T possibly damaging Het
Upf1 T C 8: 70,344,268 E105G possibly damaging Het
Wrn A G 8: 33,324,394 W341R probably benign Het
Xndc1 C T 7: 102,080,547 P267L probably benign Het
Zbtb26 T C 2: 37,436,884 T47A probably benign Het
Zc3h10 A T 10: 128,544,294 V398E probably damaging Het
Zfp652 G T 11: 95,749,095 probably benign Het
Other mutations in Ap3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Ap3b1 APN 13 94390863 missense probably damaging 1.00
IGL00766:Ap3b1 APN 13 94542884 splice site probably benign
IGL01784:Ap3b1 APN 13 94493739 missense probably damaging 1.00
IGL01979:Ap3b1 APN 13 94448463 nonsense probably null
IGL02040:Ap3b1 APN 13 94408845 critical splice donor site probably null
IGL02119:Ap3b1 APN 13 94462403 missense probably benign 0.01
IGL02247:Ap3b1 APN 13 94394795 critical splice donor site probably null
IGL02303:Ap3b1 APN 13 94528319 missense unknown
IGL02493:Ap3b1 APN 13 94404020 missense probably damaging 0.98
IGL02551:Ap3b1 APN 13 94418091 missense probably damaging 0.99
IGL02651:Ap3b1 APN 13 94477021 missense probably damaging 1.00
IGL02832:Ap3b1 APN 13 94528327 missense unknown
IGL03033:Ap3b1 APN 13 94448495 missense probably benign 0.15
IGL03101:Ap3b1 APN 13 94455398 missense probably benign 0.00
bella UTSW 13 94528257 missense unknown
bullet_gray UTSW 13 94451086 critical splice donor site probably benign
cuttlefish UTSW 13 94448451 critical splice acceptor site probably null
Gastropod UTSW 13 94542840 missense unknown
razor UTSW 13 94493731 missense unknown
Slime UTSW 13 94404078 missense possibly damaging 0.51
slug UTSW 13 94408845 critical splice donor site probably null
snail UTSW 13 94479885 splice site probably benign
stalk UTSW 13 94472931 critical splice donor site probably null
R0034:Ap3b1 UTSW 13 94479885 splice site probably benign
R0265:Ap3b1 UTSW 13 94493681 missense unknown
R0270:Ap3b1 UTSW 13 94404118 splice site probably benign
R0346:Ap3b1 UTSW 13 94445971 nonsense probably null
R0422:Ap3b1 UTSW 13 94462460 missense probably damaging 0.99
R0496:Ap3b1 UTSW 13 94472938 splice site probably benign
R0508:Ap3b1 UTSW 13 94565714 missense unknown
R0764:Ap3b1 UTSW 13 94479879 splice site probably benign
R1506:Ap3b1 UTSW 13 94446143 splice site probably benign
R1593:Ap3b1 UTSW 13 94501927 missense unknown
R1660:Ap3b1 UTSW 13 94408812 missense probably damaging 0.98
R1735:Ap3b1 UTSW 13 94493717 missense unknown
R1791:Ap3b1 UTSW 13 94408797 missense possibly damaging 0.63
R1818:Ap3b1 UTSW 13 94471704 missense possibly damaging 0.48
R2280:Ap3b1 UTSW 13 94528216 missense unknown
R3031:Ap3b1 UTSW 13 94565643 missense unknown
R3037:Ap3b1 UTSW 13 94445978 critical splice donor site probably null
R4401:Ap3b1 UTSW 13 94418099 missense probably damaging 1.00
R4402:Ap3b1 UTSW 13 94418099 missense probably damaging 1.00
R4403:Ap3b1 UTSW 13 94418099 missense probably damaging 1.00
R4532:Ap3b1 UTSW 13 94565735 missense unknown
R4624:Ap3b1 UTSW 13 94483226 missense unknown
R4626:Ap3b1 UTSW 13 94404078 missense possibly damaging 0.51
R4754:Ap3b1 UTSW 13 94403960 missense probably damaging 1.00
R4788:Ap3b1 UTSW 13 94565641 missense unknown
R4847:Ap3b1 UTSW 13 94471779 missense probably benign 0.15
R4886:Ap3b1 UTSW 13 94472805 missense possibly damaging 0.50
R5096:Ap3b1 UTSW 13 94479849 missense unknown
R5628:Ap3b1 UTSW 13 94477048 missense unknown
R5671:Ap3b1 UTSW 13 94528257 missense unknown
R5677:Ap3b1 UTSW 13 94528196 missense unknown
R5862:Ap3b1 UTSW 13 94547770 missense unknown
R5941:Ap3b1 UTSW 13 94440273 missense probably benign 0.02
R5941:Ap3b1 UTSW 13 94483265 missense probably damaging 0.96
R6043:Ap3b1 UTSW 13 94476993 missense probably benign 0.09
R6212:Ap3b1 UTSW 13 94451073 missense probably damaging 1.00
R6212:Ap3b1 UTSW 13 94493699 missense unknown
R6301:Ap3b1 UTSW 13 94528295 missense unknown
R6765:Ap3b1 UTSW 13 94462509 missense probably benign 0.02
R6812:Ap3b1 UTSW 13 94479861 missense unknown
R6888:Ap3b1 UTSW 13 94408791 missense probably benign 0.42
R6901:Ap3b1 UTSW 13 94418142 missense probably benign 0.00
R7157:Ap3b1 UTSW 13 94532034 nonsense probably null
R7422:Ap3b1 UTSW 13 94528165 missense unknown
R7642:Ap3b1 UTSW 13 94477032 missense probably benign 0.19
R7710:Ap3b1 UTSW 13 94451073 missense probably damaging 1.00
R7757:Ap3b1 UTSW 13 94528158 splice site probably null
R7867:Ap3b1 UTSW 13 94483263 missense unknown
R8492:Ap3b1 UTSW 13 94394786 missense possibly damaging 0.60
R8706:Ap3b1 UTSW 13 94408845 critical splice donor site probably null
R8749:Ap3b1 UTSW 13 94528217 missense unknown
R8889:Ap3b1 UTSW 13 94542840 missense unknown
R8892:Ap3b1 UTSW 13 94542840 missense unknown
R9065:Ap3b1 UTSW 13 94471715 missense probably damaging 1.00
R9152:Ap3b1 UTSW 13 94472931 critical splice donor site probably null
R9152:Ap3b1 UTSW 13 94493731 missense unknown
R9166:Ap3b1 UTSW 13 94471728 missense probably damaging 1.00
R9218:Ap3b1 UTSW 13 94448451 critical splice acceptor site probably null
R9269:Ap3b1 UTSW 13 94404062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGTCTCTGGAAATGTAAACTTG -3'
(R):5'- GATATCCCTGGGAGATCTGCTC -3'

Sequencing Primer
(F):5'- GAAATTTTGATGGGCATTTTCACTG -3'
(R):5'- GGGAGATCTGCTCTTTTACTTAAAG -3'
Posted On 2021-07-15