Incidental Mutation 'R8876:1110004E09Rik'
ID 676600
Institutional Source Beutler Lab
Gene Symbol 1110004E09Rik
Ensembl Gene ENSMUSG00000022972
Gene Name RIKEN cDNA 1110004E09 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock # R8876 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 90925809-90935114 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 90927393 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 164 (I164T)
Ref Sequence ENSEMBL: ENSMUSP00000023694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023694] [ENSMUST00000125519] [ENSMUST00000142340] [ENSMUST00000149833]
AlphaFold Q8BL95
Predicted Effect possibly damaging
Transcript: ENSMUST00000023694
AA Change: I164T

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000023694
Gene: ENSMUSG00000022972
AA Change: I164T

DomainStartEndE-ValueType
Pfam:DUF2870 189 285 4.7e-47 PFAM
Predicted Effect silent
Transcript: ENSMUST00000125519
Predicted Effect
SMART Domains Protein: ENSMUSP00000122163
Gene: ENSMUSG00000022972
AA Change: I61T

DomainStartEndE-ValueType
Pfam:DUF2870 87 122 6.2e-17 PFAM
Pfam:DUF2870 118 151 4.8e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000142340
AA Change: I120T

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000149833
AA Change: I147T

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123417
Gene: ENSMUSG00000022972
AA Change: I147T

DomainStartEndE-ValueType
Pfam:DUF2870 171 198 5.8e-14 PFAM
Meta Mutation Damage Score 0.3624 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene a protein plays a critical role in dynein arm assembly and motile cilia function. Mutations in this gene result in primary ciliary dyskinesia. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accs A C 2: 93,838,058 L356R probably damaging Het
Acvr1 A T 2: 58,448,410 D433E possibly damaging Het
Aldh3b1 A G 19: 3,921,502 L122P probably damaging Het
Ap3b1 T G 13: 94,404,078 N169K possibly damaging Het
Apbb2 A G 5: 66,451,657 S216P probably benign Het
Arap3 T A 18: 37,997,024 H28L possibly damaging Het
Arhgap44 C T 11: 65,008,070 M760I possibly damaging Het
Arhgef19 G T 4: 141,247,882 A304S probably benign Het
Arntl2 G A 6: 146,821,994 G274D probably benign Het
Atpaf1 T C 4: 115,788,351 I139T possibly damaging Het
BC024139 G T 15: 76,126,120 T62K possibly damaging Het
Capn5 T C 7: 98,131,695 T292A probably benign Het
Card19 T C 13: 49,205,338 N53S possibly damaging Het
Cep97 A G 16: 55,922,104 V232A possibly damaging Het
Clca2 G T 3: 145,071,599 T837K probably benign Het
Col8a2 G C 4: 126,310,854 G219A probably damaging Het
Ctu2 T C 8: 122,480,212 S365P Het
Dnah2 T C 11: 69,491,522 D1254G probably damaging Het
Dscam A G 16: 96,619,628 L1686S probably damaging Het
Fgr A G 4: 132,998,760 probably benign Het
Frmd4a T A 2: 4,601,300 S612T probably damaging Het
Gadd45gip1 T C 8: 84,834,119 I121T probably damaging Het
Gapvd1 A G 2: 34,678,548 V1353A possibly damaging Het
Gdf3 G A 6: 122,606,983 P142S probably damaging Het
Gm19965 G A 1: 116,822,046 G486R unknown Het
Gpatch2l T C 12: 86,261,631 L307P probably damaging Het
Grm3 T C 5: 9,511,580 K757E probably damaging Het
Inppl1 T A 7: 101,823,543 H1218L possibly damaging Het
Jag2 T C 12: 112,909,637 I1055V probably benign Het
Krtap9-5 G T 11: 99,949,514 C347F unknown Het
Magi2 T A 5: 20,651,192 Y1050* probably null Het
Myrf A G 19: 10,229,014 probably benign Het
Ntpcr T G 8: 125,738,046 probably benign Het
Olfr1386 T C 11: 49,470,559 M136T probably damaging Het
Olfr404-ps1 C T 11: 74,240,020 T152I probably damaging Het
Olfr525 T C 7: 140,322,803 Y35H probably damaging Het
Palmd T G 3: 116,927,250 D145A probably damaging Het
Pdcd1 A G 1: 94,052,430 S21P probably benign Het
Pkn1 T C 8: 83,672,250 T696A possibly damaging Het
Pnpt1 T A 11: 29,146,769 probably benign Het
Sbf2 T A 7: 110,449,939 I273F probably damaging Het
Slc16a4 A T 3: 107,300,785 N204Y probably benign Het
Slc38a1 T C 15: 96,616,210 I44V possibly damaging Het
Smpdl3a T C 10: 57,809,070 V312A probably damaging Het
Ston1 A G 17: 88,635,172 Y2C probably benign Het
Syde1 A T 10: 78,589,491 Y229N probably damaging Het
Ttc37 T G 13: 76,175,284 D1382E probably benign Het
Ttc6 T A 12: 57,737,703 C1853S possibly damaging Het
Ttn A G 2: 76,778,905 I17650T possibly damaging Het
Upf1 T C 8: 70,344,268 E105G possibly damaging Het
Wrn A G 8: 33,324,394 W341R probably benign Het
Xndc1 C T 7: 102,080,547 P267L probably benign Het
Zbtb26 T C 2: 37,436,884 T47A probably benign Het
Zc3h10 A T 10: 128,544,294 V398E probably damaging Het
Zfp652 G T 11: 95,749,095 probably benign Het
Other mutations in 1110004E09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:1110004E09Rik APN 16 90926048 missense possibly damaging 0.60
IGL02607:1110004E09Rik APN 16 90929947 missense probably damaging 1.00
IGL02826:1110004E09Rik APN 16 90926062 missense probably benign 0.02
R0920:1110004E09Rik UTSW 16 90927379 missense probably damaging 0.98
R4586:1110004E09Rik UTSW 16 90927426 missense probably damaging 1.00
R5415:1110004E09Rik UTSW 16 90926065 missense probably benign 0.05
R5443:1110004E09Rik UTSW 16 90927211 missense probably benign
R8114:1110004E09Rik UTSW 16 90934657 missense probably benign
R8191:1110004E09Rik UTSW 16 90931001 missense probably damaging 0.99
R8699:1110004E09Rik UTSW 16 90931057 missense probably benign 0.03
R9440:1110004E09Rik UTSW 16 90929944 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GCTGCCTGTGGTCAGTTATAC -3'
(R):5'- GACGGTAGTCACCCTGAAAG -3'

Sequencing Primer
(F):5'- CCTGTGGTCAGTTATACAACACAGG -3'
(R):5'- CAAGGTCCTCATGGGGTAAC -3'
Posted On 2021-07-15