Incidental Mutation 'R8876:Dscam'
ID 676601
Institutional Source Beutler Lab
Gene Symbol Dscam
Ensembl Gene ENSMUSG00000050272
Gene Name DS cell adhesion molecule
Synonyms 4932410A21Rik, Down syndrome cell adhesion molecule
MMRRC Submission 068688-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8876 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 96392040-96971952 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 96420828 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 1686 (L1686S)
Ref Sequence ENSEMBL: ENSMUSP00000056040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056102]
AlphaFold Q9ERC8
Predicted Effect probably damaging
Transcript: ENSMUST00000056102
AA Change: L1686S

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000056040
Gene: ENSMUSG00000050272
AA Change: L1686S

DomainStartEndE-ValueType
IG_like 37 109 1.47e0 SMART
IG 130 218 8.33e-1 SMART
IGc2 237 300 8.7e-13 SMART
IGc2 326 392 1.24e-8 SMART
IGc2 419 491 1.1e-9 SMART
IGc2 516 582 1.99e-7 SMART
IGc2 608 676 1.84e-11 SMART
IGc2 702 773 6.01e-16 SMART
IG 794 883 1.73e-7 SMART
FN3 885 969 7.34e-9 SMART
FN3 985 1073 4.06e-11 SMART
FN3 1088 1174 7.23e-8 SMART
FN3 1189 1270 2.6e-9 SMART
IGc2 1301 1366 2.05e-9 SMART
FN3 1380 1460 7.17e-12 SMART
FN3 1477 1557 4.35e1 SMART
transmembrane domain 1595 1617 N/A INTRINSIC
low complexity region 1799 1809 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the immunoglobulin superfamily of cell adhesion molecules (Ig-CAMs), and is involved in human central and peripheral nervous system development. This gene is a candidate for Down syndrome and congenital heart disease (DSCHD). A gene encoding a similar Ig-CAM protein is located on chromosome 11. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit background-sensitive perinatal lethality associated with respiratory distress, altered C4 ventral root and pre-inspiratory neuron signaling, and abnormal response to hypercapnia. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(6) Gene trapped(1) Spontaneous(2)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accs A C 2: 93,668,403 (GRCm39) L356R probably damaging Het
Acvr1 A T 2: 58,338,422 (GRCm39) D433E possibly damaging Het
Aldh3b1 A G 19: 3,971,502 (GRCm39) L122P probably damaging Het
Ap3b1 T G 13: 94,540,586 (GRCm39) N169K possibly damaging Het
Apbb2 A G 5: 66,609,000 (GRCm39) S216P probably benign Het
Arap3 T A 18: 38,130,077 (GRCm39) H28L possibly damaging Het
Arhgap44 C T 11: 64,898,896 (GRCm39) M760I possibly damaging Het
Arhgef19 G T 4: 140,975,193 (GRCm39) A304S probably benign Het
Atpaf1 T C 4: 115,645,548 (GRCm39) I139T possibly damaging Het
BC024139 G T 15: 76,010,320 (GRCm39) T62K possibly damaging Het
Bmal2 G A 6: 146,723,492 (GRCm39) G274D probably benign Het
Capn5 T C 7: 97,780,902 (GRCm39) T292A probably benign Het
Card19 T C 13: 49,358,814 (GRCm39) N53S possibly damaging Het
Cep97 A G 16: 55,742,467 (GRCm39) V232A possibly damaging Het
Cfap298 A G 16: 90,724,281 (GRCm39) I164T possibly damaging Het
Clca3a2 G T 3: 144,777,360 (GRCm39) T837K probably benign Het
Col8a2 G C 4: 126,204,647 (GRCm39) G219A probably damaging Het
Ctu2 T C 8: 123,206,951 (GRCm39) S365P Het
Dnah2 T C 11: 69,382,348 (GRCm39) D1254G probably damaging Het
Fgr A G 4: 132,726,071 (GRCm39) probably benign Het
Frmd4a T A 2: 4,606,111 (GRCm39) S612T probably damaging Het
Gadd45gip1 T C 8: 85,560,748 (GRCm39) I121T probably damaging Het
Gapvd1 A G 2: 34,568,560 (GRCm39) V1353A possibly damaging Het
Gdf3 G A 6: 122,583,942 (GRCm39) P142S probably damaging Het
Gm19965 G A 1: 116,749,776 (GRCm39) G486R unknown Het
Gpatch2l T C 12: 86,308,405 (GRCm39) L307P probably damaging Het
Grm3 T C 5: 9,561,580 (GRCm39) K757E probably damaging Het
Inppl1 T A 7: 101,472,750 (GRCm39) H1218L possibly damaging Het
Jag2 T C 12: 112,873,257 (GRCm39) I1055V probably benign Het
Krtap9-5 G T 11: 99,840,340 (GRCm39) C347F unknown Het
Magi2 T A 5: 20,856,190 (GRCm39) Y1050* probably null Het
Myrf A G 19: 10,206,378 (GRCm39) probably benign Het
Ntpcr T G 8: 126,464,785 (GRCm39) probably benign Het
Or13a19 T C 7: 139,902,716 (GRCm39) Y35H probably damaging Het
Or1p1b C T 11: 74,130,846 (GRCm39) T152I probably damaging Het
Or2y1c T C 11: 49,361,386 (GRCm39) M136T probably damaging Het
Palmd T G 3: 116,720,899 (GRCm39) D145A probably damaging Het
Pdcd1 A G 1: 93,980,155 (GRCm39) S21P probably benign Het
Pkn1 T C 8: 84,398,879 (GRCm39) T696A possibly damaging Het
Pnpt1 T A 11: 29,096,769 (GRCm39) probably benign Het
Sbf2 T A 7: 110,049,146 (GRCm39) I273F probably damaging Het
Skic3 T G 13: 76,323,403 (GRCm39) D1382E probably benign Het
Slc16a4 A T 3: 107,208,101 (GRCm39) N204Y probably benign Het
Slc38a1 T C 15: 96,514,091 (GRCm39) I44V possibly damaging Het
Smpdl3a T C 10: 57,685,166 (GRCm39) V312A probably damaging Het
Ston1 A G 17: 88,942,600 (GRCm39) Y2C probably benign Het
Syde1 A T 10: 78,425,325 (GRCm39) Y229N probably damaging Het
Ttc6 T A 12: 57,784,489 (GRCm39) C1853S possibly damaging Het
Ttn A G 2: 76,609,249 (GRCm39) I17650T possibly damaging Het
Upf1 T C 8: 70,796,918 (GRCm39) E105G possibly damaging Het
Wrn A G 8: 33,814,422 (GRCm39) W341R probably benign Het
Xndc1 C T 7: 101,729,754 (GRCm39) P267L probably benign Het
Zbtb26 T C 2: 37,326,896 (GRCm39) T47A probably benign Het
Zc3h10 A T 10: 128,380,163 (GRCm39) V398E probably damaging Het
Zfp652 G T 11: 95,639,921 (GRCm39) probably benign Het
Other mutations in Dscam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dscam APN 16 96,409,265 (GRCm39) missense possibly damaging 0.64
IGL00841:Dscam APN 16 96,621,077 (GRCm39) missense probably damaging 1.00
IGL01289:Dscam APN 16 96,445,082 (GRCm39) nonsense probably null
IGL01358:Dscam APN 16 96,411,543 (GRCm39) missense possibly damaging 0.68
IGL01431:Dscam APN 16 96,453,278 (GRCm39) critical splice donor site probably null
IGL01444:Dscam APN 16 96,474,909 (GRCm39) missense possibly damaging 0.95
IGL01767:Dscam APN 16 96,456,136 (GRCm39) missense probably damaging 1.00
IGL01866:Dscam APN 16 96,486,550 (GRCm39) missense probably benign 0.06
IGL02020:Dscam APN 16 96,517,269 (GRCm39) missense probably damaging 1.00
IGL02023:Dscam APN 16 96,602,397 (GRCm39) missense probably benign 0.06
IGL02057:Dscam APN 16 96,517,273 (GRCm39) nonsense probably null
IGL02389:Dscam APN 16 96,442,097 (GRCm39) missense probably benign 0.27
IGL02409:Dscam APN 16 96,621,088 (GRCm39) missense possibly damaging 0.46
IGL02694:Dscam APN 16 96,394,476 (GRCm39) missense probably benign 0.00
IGL02899:Dscam APN 16 96,510,447 (GRCm39) missense probably damaging 0.98
IGL02956:Dscam APN 16 96,602,472 (GRCm39) missense probably damaging 0.98
IGL03035:Dscam APN 16 96,621,170 (GRCm39) missense possibly damaging 0.94
IGL03191:Dscam APN 16 96,621,969 (GRCm39) missense probably benign 0.36
growler UTSW 16 96,622,197 (GRCm39) missense probably damaging 0.99
Twostep UTSW 16 96,626,982 (GRCm39) splice site probably null
F6893:Dscam UTSW 16 96,857,660 (GRCm39) missense possibly damaging 0.78
K3955:Dscam UTSW 16 96,474,887 (GRCm39) missense probably benign 0.00
R0024:Dscam UTSW 16 96,394,585 (GRCm39) nonsense probably null
R0057:Dscam UTSW 16 96,474,936 (GRCm39) missense probably damaging 1.00
R0057:Dscam UTSW 16 96,474,936 (GRCm39) missense probably damaging 1.00
R0117:Dscam UTSW 16 96,474,878 (GRCm39) missense probably benign 0.33
R0211:Dscam UTSW 16 96,517,279 (GRCm39) missense possibly damaging 0.50
R0280:Dscam UTSW 16 96,840,206 (GRCm39) missense possibly damaging 0.62
R0355:Dscam UTSW 16 96,456,105 (GRCm39) missense probably benign 0.00
R0380:Dscam UTSW 16 96,857,810 (GRCm39) missense probably damaging 1.00
R0445:Dscam UTSW 16 96,573,703 (GRCm39) missense probably damaging 1.00
R0492:Dscam UTSW 16 96,626,982 (GRCm39) splice site probably null
R0534:Dscam UTSW 16 96,453,372 (GRCm39) missense possibly damaging 0.67
R0593:Dscam UTSW 16 96,573,608 (GRCm39) missense probably benign 0.19
R0707:Dscam UTSW 16 96,626,982 (GRCm39) splice site probably null
R0738:Dscam UTSW 16 96,620,981 (GRCm39) missense possibly damaging 0.48
R1017:Dscam UTSW 16 96,634,633 (GRCm39) missense probably damaging 1.00
R1377:Dscam UTSW 16 96,573,694 (GRCm39) missense probably damaging 1.00
R1440:Dscam UTSW 16 96,621,151 (GRCm39) missense probably damaging 1.00
R1442:Dscam UTSW 16 96,409,274 (GRCm39) missense possibly damaging 0.94
R1464:Dscam UTSW 16 96,602,453 (GRCm39) missense possibly damaging 0.94
R1464:Dscam UTSW 16 96,602,453 (GRCm39) missense possibly damaging 0.94
R1478:Dscam UTSW 16 96,592,110 (GRCm39) missense probably benign 0.15
R1530:Dscam UTSW 16 96,621,074 (GRCm39) missense probably damaging 1.00
R1731:Dscam UTSW 16 96,621,076 (GRCm39) missense probably damaging 1.00
R1765:Dscam UTSW 16 96,486,579 (GRCm39) missense probably benign 0.00
R1824:Dscam UTSW 16 96,626,781 (GRCm39) missense probably benign 0.00
R1933:Dscam UTSW 16 96,394,414 (GRCm39) missense probably benign 0.00
R2005:Dscam UTSW 16 96,840,120 (GRCm39) missense probably benign 0.02
R2006:Dscam UTSW 16 96,621,112 (GRCm39) missense probably damaging 1.00
R2101:Dscam UTSW 16 96,411,549 (GRCm39) missense probably benign 0.00
R2177:Dscam UTSW 16 96,411,524 (GRCm39) missense probably damaging 0.98
R2342:Dscam UTSW 16 96,420,702 (GRCm39) missense probably damaging 1.00
R2851:Dscam UTSW 16 96,423,915 (GRCm39) missense possibly damaging 0.94
R2929:Dscam UTSW 16 96,486,612 (GRCm39) missense possibly damaging 0.76
R3055:Dscam UTSW 16 96,602,555 (GRCm39) missense probably damaging 1.00
R3157:Dscam UTSW 16 96,479,710 (GRCm39) missense probably benign 0.16
R3159:Dscam UTSW 16 96,479,710 (GRCm39) missense probably benign 0.16
R3944:Dscam UTSW 16 96,622,197 (GRCm39) missense probably damaging 0.99
R4080:Dscam UTSW 16 96,484,972 (GRCm39) missense probably benign 0.01
R4285:Dscam UTSW 16 96,510,309 (GRCm39) critical splice donor site probably null
R4384:Dscam UTSW 16 96,510,416 (GRCm39) missense probably damaging 0.99
R4460:Dscam UTSW 16 96,411,519 (GRCm39) missense probably damaging 1.00
R4575:Dscam UTSW 16 96,626,823 (GRCm39) missense possibly damaging 0.82
R4594:Dscam UTSW 16 96,519,196 (GRCm39) missense possibly damaging 0.78
R4643:Dscam UTSW 16 96,486,501 (GRCm39) missense probably damaging 0.96
R4698:Dscam UTSW 16 96,411,524 (GRCm39) missense probably damaging 1.00
R4716:Dscam UTSW 16 96,420,771 (GRCm39) missense possibly damaging 0.80
R4743:Dscam UTSW 16 96,631,256 (GRCm39) missense probably benign 0.00
R4766:Dscam UTSW 16 96,445,188 (GRCm39) missense probably benign 0.02
R4899:Dscam UTSW 16 96,485,018 (GRCm39) missense probably benign 0.01
R4987:Dscam UTSW 16 96,498,721 (GRCm39) missense probably benign 0.00
R4990:Dscam UTSW 16 96,626,715 (GRCm39) missense probably benign 0.12
R5123:Dscam UTSW 16 96,573,637 (GRCm39) missense probably damaging 1.00
R5130:Dscam UTSW 16 96,620,979 (GRCm39) missense probably benign 0.00
R5328:Dscam UTSW 16 96,474,878 (GRCm39) missense probably benign 0.33
R5666:Dscam UTSW 16 96,519,364 (GRCm39) missense probably benign 0.23
R5670:Dscam UTSW 16 96,519,364 (GRCm39) missense probably benign 0.23
R5678:Dscam UTSW 16 96,592,100 (GRCm39) missense probably benign 0.16
R5827:Dscam UTSW 16 96,451,191 (GRCm39) critical splice donor site probably null
R5907:Dscam UTSW 16 96,622,120 (GRCm39) missense probably damaging 0.97
R6032:Dscam UTSW 16 96,451,191 (GRCm39) critical splice donor site probably null
R6032:Dscam UTSW 16 96,451,191 (GRCm39) critical splice donor site probably null
R6103:Dscam UTSW 16 96,626,781 (GRCm39) missense probably benign
R6240:Dscam UTSW 16 96,420,702 (GRCm39) missense probably damaging 1.00
R6257:Dscam UTSW 16 96,474,914 (GRCm39) missense possibly damaging 0.94
R6361:Dscam UTSW 16 96,424,011 (GRCm39) missense probably benign 0.08
R6405:Dscam UTSW 16 96,479,625 (GRCm39) missense probably damaging 1.00
R6444:Dscam UTSW 16 96,420,844 (GRCm39) missense probably damaging 1.00
R6560:Dscam UTSW 16 96,626,935 (GRCm39) missense probably benign 0.00
R6598:Dscam UTSW 16 96,620,984 (GRCm39) missense probably damaging 1.00
R6622:Dscam UTSW 16 96,446,273 (GRCm39) missense probably benign 0.06
R6792:Dscam UTSW 16 96,449,437 (GRCm39) missense probably damaging 1.00
R6792:Dscam UTSW 16 96,394,455 (GRCm39) missense probably damaging 0.96
R6827:Dscam UTSW 16 96,840,191 (GRCm39) missense probably damaging 1.00
R6868:Dscam UTSW 16 96,631,140 (GRCm39) missense probably damaging 1.00
R6898:Dscam UTSW 16 96,631,100 (GRCm39) missense probably benign 0.02
R6903:Dscam UTSW 16 96,621,988 (GRCm39) missense probably damaging 1.00
R7051:Dscam UTSW 16 96,620,986 (GRCm39) missense probably benign 0.01
R7146:Dscam UTSW 16 96,631,117 (GRCm39) nonsense probably null
R7180:Dscam UTSW 16 96,626,764 (GRCm39) missense probably damaging 0.97
R7209:Dscam UTSW 16 96,451,544 (GRCm39) splice site probably null
R7247:Dscam UTSW 16 96,622,008 (GRCm39) missense probably damaging 0.99
R7269:Dscam UTSW 16 96,479,601 (GRCm39) missense probably benign 0.00
R7301:Dscam UTSW 16 96,857,732 (GRCm39) missense probably benign 0.01
R7328:Dscam UTSW 16 96,446,235 (GRCm39) nonsense probably null
R7368:Dscam UTSW 16 96,445,131 (GRCm39) missense probably benign 0.00
R7425:Dscam UTSW 16 96,430,598 (GRCm39) missense probably damaging 1.00
R7474:Dscam UTSW 16 96,621,089 (GRCm39) missense possibly damaging 0.88
R7536:Dscam UTSW 16 96,442,226 (GRCm39) splice site probably null
R7624:Dscam UTSW 16 96,411,524 (GRCm39) missense probably damaging 1.00
R7766:Dscam UTSW 16 96,592,101 (GRCm39) missense probably benign 0.31
R7817:Dscam UTSW 16 96,442,064 (GRCm39) missense probably benign
R7843:Dscam UTSW 16 96,626,830 (GRCm39) missense probably damaging 0.99
R7911:Dscam UTSW 16 96,445,122 (GRCm39) missense probably benign 0.01
R8108:Dscam UTSW 16 96,445,079 (GRCm39) missense probably benign 0.01
R8128:Dscam UTSW 16 96,602,374 (GRCm39) splice site probably null
R8770:Dscam UTSW 16 96,456,106 (GRCm39) missense possibly damaging 0.50
R9005:Dscam UTSW 16 96,602,580 (GRCm39) missense probably damaging 1.00
R9009:Dscam UTSW 16 96,840,116 (GRCm39) missense probably benign 0.10
R9168:Dscam UTSW 16 96,420,768 (GRCm39) missense possibly damaging 0.82
R9176:Dscam UTSW 16 96,486,553 (GRCm39) missense probably benign 0.37
R9244:Dscam UTSW 16 96,486,429 (GRCm39) missense possibly damaging 0.62
R9339:Dscam UTSW 16 96,517,263 (GRCm39) missense possibly damaging 0.89
R9374:Dscam UTSW 16 96,857,857 (GRCm39) missense probably benign 0.19
R9385:Dscam UTSW 16 96,840,203 (GRCm39) missense probably benign
R9674:Dscam UTSW 16 96,442,036 (GRCm39) missense probably benign 0.03
X0025:Dscam UTSW 16 96,510,361 (GRCm39) missense probably damaging 1.00
Z1088:Dscam UTSW 16 96,573,761 (GRCm39) missense probably benign 0.01
Z1177:Dscam UTSW 16 96,409,389 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATTGGTGTGTGATTGAGAAAGCCC -3'
(R):5'- AGCTACACCGAGTGACGTTG -3'

Sequencing Primer
(F):5'- AAGCCCAACCTTTTATTTTCGAGGG -3'
(R):5'- CGTTGTTTTCACAAGAAGCCGAG -3'
Posted On 2021-07-15