Incidental Mutation 'R8877:Unc80'
ID 676606
Institutional Source Beutler Lab
Gene Symbol Unc80
Ensembl Gene ENSMUSG00000055567
Gene Name unc-80, NALCN activator
Synonyms C230061B10Rik, C030018G13Rik
MMRRC Submission 068745-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.891) question?
Stock # R8877 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 66507526-66738307 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 66567144 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 917 (S917P)
Ref Sequence ENSEMBL: ENSMUSP00000053692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061620] [ENSMUST00000212557]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000061620
AA Change: S917P

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000053692
Gene: ENSMUSG00000055567
AA Change: S917P

DomainStartEndE-ValueType
Pfam:UNC80 16 236 2.2e-94 PFAM
low complexity region 372 385 N/A INTRINSIC
low complexity region 493 502 N/A INTRINSIC
low complexity region 693 711 N/A INTRINSIC
low complexity region 723 738 N/A INTRINSIC
low complexity region 739 769 N/A INTRINSIC
low complexity region 1038 1055 N/A INTRINSIC
low complexity region 1067 1084 N/A INTRINSIC
low complexity region 1309 1328 N/A INTRINSIC
low complexity region 1477 1489 N/A INTRINSIC
low complexity region 1676 1681 N/A INTRINSIC
low complexity region 1842 1848 N/A INTRINSIC
low complexity region 1854 1868 N/A INTRINSIC
low complexity region 2461 2480 N/A INTRINSIC
low complexity region 2726 2740 N/A INTRINSIC
low complexity region 3121 3144 N/A INTRINSIC
low complexity region 3245 3254 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000212557
AA Change: S917P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a voltage-independent 'leak' ion-channel complex, in which it performs essential functions, such as serving as a bridge between two other components (sodium leak channel non-selective and UNC79) and as a scaffold for Src kinases. Leak channels play an importnat role in establishment and maintenance of resting membrane potentials in neurons. Mutations in this gene are associated with congenital infantile encephalopathy, intellectual disability and growth issues. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T A 7: 12,288,704 (GRCm39) probably null Het
Acp2 G A 2: 91,036,129 (GRCm39) R109H probably damaging Het
Adamts8 T C 9: 30,862,688 (GRCm39) S298P probably damaging Het
Anxa7 A G 14: 20,517,548 (GRCm39) V157A probably benign Het
Arid3b T C 9: 57,740,904 (GRCm39) K181E probably damaging Het
Armt1 A G 10: 4,400,864 (GRCm39) T204A possibly damaging Het
Brip1 A C 11: 86,043,532 (GRCm39) V344G possibly damaging Het
Ccdc40 C T 11: 119,153,992 (GRCm39) S1088L probably damaging Het
Ccdc93 A T 1: 121,403,867 (GRCm39) H332L probably benign Het
Celsr3 A G 9: 108,706,877 (GRCm39) D1120G probably damaging Het
Cep104 T A 4: 154,077,985 (GRCm39) I631N probably damaging Het
Col17a1 C T 19: 47,637,197 (GRCm39) A1354T unknown Het
Cpa2 T C 6: 30,541,692 (GRCm39) L10P probably damaging Het
Creg2 G T 1: 39,689,861 (GRCm39) T83K probably benign Het
Ddit3 T C 10: 127,131,884 (GRCm39) I144T probably damaging Het
Dmxl1 A G 18: 50,011,292 (GRCm39) I1150V possibly damaging Het
Eprs1 C T 1: 185,148,071 (GRCm39) R1278* probably null Het
Esco1 A G 18: 10,575,017 (GRCm39) V685A probably damaging Het
Gid8 C T 2: 180,358,710 (GRCm39) A125V probably damaging Het
Gin1 A G 1: 97,710,941 (GRCm39) D208G possibly damaging Het
Gja10 G A 4: 32,602,441 (GRCm39) probably benign Het
Grin2d T C 7: 45,503,699 (GRCm39) I679V probably damaging Het
Gsto2 C A 19: 47,873,176 (GRCm39) R184S probably damaging Het
Hira T A 16: 18,770,854 (GRCm39) H830Q probably benign Het
Hmcn1 G A 1: 150,514,659 (GRCm39) T3571I probably benign Het
Khnyn T C 14: 56,131,782 (GRCm39) V568A possibly damaging Het
Kif13a T A 13: 46,954,921 (GRCm39) probably null Het
Larp4b T C 13: 9,193,835 (GRCm39) V161A probably benign Het
Larp6 T A 9: 60,644,850 (GRCm39) M330K probably benign Het
Lhfpl6 A G 3: 52,950,974 (GRCm39) R83G possibly damaging Het
Mavs A G 2: 131,087,489 (GRCm39) N329S possibly damaging Het
Mep1b T A 18: 21,221,630 (GRCm39) N193K possibly damaging Het
Msantd5f6 T A 4: 73,322,468 (GRCm39) R12* probably null Het
Mttp A T 3: 137,818,317 (GRCm39) D380E probably damaging Het
Nbeal2 G A 9: 110,459,311 (GRCm39) T1939I probably damaging Het
Nsun7 A T 5: 66,453,294 (GRCm39) R670* probably null Het
Obsl1 G A 1: 75,473,167 (GRCm39) R1019* probably null Het
Or10ak12 A G 4: 118,666,482 (GRCm39) V193A probably damaging Het
Or5w11 T C 2: 87,459,212 (GRCm39) M19T probably damaging Het
Phc3 C T 3: 30,968,271 (GRCm39) V922I probably damaging Het
Pip5kl1 T C 2: 32,468,951 (GRCm39) V190A possibly damaging Het
Plekhg2 G T 7: 28,060,278 (GRCm39) T993N possibly damaging Het
Psg26 C T 7: 18,217,865 (GRCm39) V18I probably benign Het
Slc11a1 A G 1: 74,419,424 (GRCm39) Y187C probably damaging Het
Smarcd3 A G 5: 24,798,990 (GRCm39) S323P possibly damaging Het
Spen G T 4: 141,199,137 (GRCm39) Y3163* probably null Het
Stx4a T A 7: 127,447,633 (GRCm39) V259D probably damaging Het
Synj2 T C 17: 6,087,941 (GRCm39) S1331P probably damaging Het
Tmprss11c G A 5: 86,385,540 (GRCm39) Q311* probably null Het
Tpo T A 12: 30,142,738 (GRCm39) N662I probably damaging Het
Trav13d-4 C A 14: 53,995,350 (GRCm39) D101E probably damaging Het
Trbv14 G A 6: 41,112,292 (GRCm39) A30T probably benign Het
Zc3h6 T A 2: 128,856,319 (GRCm39) C466* probably null Het
Zfp462 T C 4: 55,011,097 (GRCm39) V1021A probably damaging Het
Zfp51 T C 17: 21,682,017 (GRCm39) M72T probably damaging Het
Zfp704 C T 3: 9,674,416 (GRCm39) E122K unknown Het
Zfyve26 T C 12: 79,334,152 (GRCm39) K289E probably benign Het
Other mutations in Unc80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Unc80 APN 1 66,693,554 (GRCm39) missense possibly damaging 0.53
IGL00340:Unc80 APN 1 66,645,618 (GRCm39) missense possibly damaging 0.73
IGL00783:Unc80 APN 1 66,647,596 (GRCm39) missense probably benign 0.37
IGL00784:Unc80 APN 1 66,647,596 (GRCm39) missense probably benign 0.37
IGL00935:Unc80 APN 1 66,666,425 (GRCm39) missense possibly damaging 0.53
IGL01094:Unc80 APN 1 66,734,592 (GRCm39) missense possibly damaging 0.90
IGL01466:Unc80 APN 1 66,661,645 (GRCm39) missense probably benign 0.33
IGL01577:Unc80 APN 1 66,569,127 (GRCm39) splice site probably null
IGL01626:Unc80 APN 1 66,590,213 (GRCm39) critical splice donor site probably null
IGL01640:Unc80 APN 1 66,718,744 (GRCm39) missense probably benign 0.33
IGL01775:Unc80 APN 1 66,640,215 (GRCm39) missense possibly damaging 0.94
IGL01960:Unc80 APN 1 66,647,659 (GRCm39) splice site probably benign
IGL01991:Unc80 APN 1 66,508,668 (GRCm39) nonsense probably null
IGL02022:Unc80 APN 1 66,665,675 (GRCm39) missense possibly damaging 0.53
IGL02073:Unc80 APN 1 66,651,386 (GRCm39) missense possibly damaging 0.85
IGL02077:Unc80 APN 1 66,564,875 (GRCm39) missense possibly damaging 0.77
IGL02197:Unc80 APN 1 66,569,224 (GRCm39) missense probably benign 0.39
IGL02198:Unc80 APN 1 66,569,145 (GRCm39) missense possibly damaging 0.88
IGL02228:Unc80 APN 1 66,647,587 (GRCm39) missense possibly damaging 0.72
IGL02327:Unc80 APN 1 66,680,832 (GRCm39) missense probably benign 0.33
IGL02447:Unc80 APN 1 66,542,703 (GRCm39) missense possibly damaging 0.86
IGL02489:Unc80 APN 1 66,564,860 (GRCm39) missense probably benign 0.07
IGL02546:Unc80 APN 1 66,594,112 (GRCm39) missense possibly damaging 0.83
IGL02629:Unc80 APN 1 66,522,476 (GRCm39) missense possibly damaging 0.46
IGL02631:Unc80 APN 1 66,569,222 (GRCm39) missense probably damaging 0.98
IGL02839:Unc80 APN 1 66,710,834 (GRCm39) missense possibly damaging 0.53
IGL02960:Unc80 APN 1 66,717,217 (GRCm39) splice site probably benign
IGL02974:Unc80 APN 1 66,564,817 (GRCm39) missense possibly damaging 0.95
IGL03060:Unc80 APN 1 66,676,169 (GRCm39) missense possibly damaging 0.96
IGL03062:Unc80 APN 1 66,548,648 (GRCm39) missense probably damaging 0.96
IGL03074:Unc80 APN 1 66,710,877 (GRCm39) splice site probably benign
IGL03086:Unc80 APN 1 66,548,633 (GRCm39) missense probably damaging 0.99
IGL03105:Unc80 APN 1 66,511,258 (GRCm39) missense probably damaging 0.96
IGL03107:Unc80 APN 1 66,670,613 (GRCm39) missense probably damaging 0.98
IGL03158:Unc80 APN 1 66,680,833 (GRCm39) missense probably benign 0.33
IGL03220:Unc80 APN 1 66,544,097 (GRCm39) missense probably damaging 0.99
IGL03271:Unc80 APN 1 66,734,762 (GRCm39) unclassified probably benign
IGL03332:Unc80 APN 1 66,542,790 (GRCm39) missense probably damaging 1.00
IGL03347:Unc80 APN 1 66,734,625 (GRCm39) missense probably damaging 1.00
R0012:Unc80 UTSW 1 66,546,550 (GRCm39) missense probably damaging 1.00
R0012:Unc80 UTSW 1 66,546,550 (GRCm39) missense probably damaging 1.00
R0026:Unc80 UTSW 1 66,560,743 (GRCm39) missense probably benign 0.27
R0055:Unc80 UTSW 1 66,545,782 (GRCm39) splice site probably benign
R0149:Unc80 UTSW 1 66,560,760 (GRCm39) missense possibly damaging 0.82
R0325:Unc80 UTSW 1 66,550,040 (GRCm39) missense probably damaging 1.00
R0329:Unc80 UTSW 1 66,713,246 (GRCm39) missense possibly damaging 0.96
R0330:Unc80 UTSW 1 66,713,246 (GRCm39) missense possibly damaging 0.96
R0355:Unc80 UTSW 1 66,589,015 (GRCm39) missense possibly damaging 0.77
R0412:Unc80 UTSW 1 66,590,096 (GRCm39) splice site probably benign
R0422:Unc80 UTSW 1 66,522,497 (GRCm39) missense probably damaging 1.00
R0477:Unc80 UTSW 1 66,609,160 (GRCm39) missense probably damaging 0.99
R0507:Unc80 UTSW 1 66,567,052 (GRCm39) missense possibly damaging 0.66
R0513:Unc80 UTSW 1 66,661,633 (GRCm39) missense possibly damaging 0.73
R0553:Unc80 UTSW 1 66,545,828 (GRCm39) missense probably damaging 0.97
R0626:Unc80 UTSW 1 66,647,601 (GRCm39) missense probably benign 0.01
R0655:Unc80 UTSW 1 66,542,940 (GRCm39) missense probably damaging 0.98
R0742:Unc80 UTSW 1 66,567,052 (GRCm39) missense possibly damaging 0.66
R0755:Unc80 UTSW 1 66,544,082 (GRCm39) missense probably damaging 1.00
R0782:Unc80 UTSW 1 66,661,740 (GRCm39) missense possibly damaging 0.53
R0837:Unc80 UTSW 1 66,688,103 (GRCm39) missense possibly damaging 0.73
R0841:Unc80 UTSW 1 66,511,247 (GRCm39) missense probably damaging 1.00
R0893:Unc80 UTSW 1 66,560,645 (GRCm39) missense probably damaging 0.97
R0900:Unc80 UTSW 1 66,710,757 (GRCm39) missense probably benign 0.33
R0924:Unc80 UTSW 1 66,549,800 (GRCm39) missense possibly damaging 0.95
R0930:Unc80 UTSW 1 66,549,800 (GRCm39) missense possibly damaging 0.95
R0989:Unc80 UTSW 1 66,685,599 (GRCm39) missense possibly damaging 0.53
R1145:Unc80 UTSW 1 66,511,247 (GRCm39) missense probably damaging 1.00
R1145:Unc80 UTSW 1 66,511,247 (GRCm39) missense probably damaging 1.00
R1224:Unc80 UTSW 1 66,511,139 (GRCm39) missense probably damaging 1.00
R1240:Unc80 UTSW 1 66,675,061 (GRCm39) missense possibly damaging 0.85
R1245:Unc80 UTSW 1 66,594,254 (GRCm39) missense possibly damaging 0.94
R1467:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R1473:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R1500:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R1556:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R1562:Unc80 UTSW 1 66,677,116 (GRCm39) missense probably damaging 1.00
R1655:Unc80 UTSW 1 66,711,915 (GRCm39) missense possibly damaging 0.86
R1674:Unc80 UTSW 1 66,548,467 (GRCm39) missense probably damaging 1.00
R1680:Unc80 UTSW 1 66,542,828 (GRCm39) nonsense probably null
R1739:Unc80 UTSW 1 66,567,051 (GRCm39) missense probably damaging 0.97
R1756:Unc80 UTSW 1 66,678,407 (GRCm39) missense possibly damaging 0.53
R1783:Unc80 UTSW 1 66,722,432 (GRCm39) missense probably benign 0.01
R1834:Unc80 UTSW 1 66,678,407 (GRCm39) missense possibly damaging 0.53
R1854:Unc80 UTSW 1 66,670,573 (GRCm39) missense possibly damaging 0.93
R1871:Unc80 UTSW 1 66,549,876 (GRCm39) missense possibly damaging 0.77
R1878:Unc80 UTSW 1 66,548,561 (GRCm39) missense probably damaging 0.96
R1883:Unc80 UTSW 1 66,564,929 (GRCm39) missense possibly damaging 0.89
R1912:Unc80 UTSW 1 66,549,784 (GRCm39) missense probably damaging 1.00
R1990:Unc80 UTSW 1 66,731,708 (GRCm39) missense probably damaging 0.97
R2007:Unc80 UTSW 1 66,542,935 (GRCm39) missense probably damaging 1.00
R2035:Unc80 UTSW 1 66,645,752 (GRCm39) missense probably damaging 0.98
R2056:Unc80 UTSW 1 66,679,711 (GRCm39) missense possibly damaging 0.72
R2060:Unc80 UTSW 1 66,679,754 (GRCm39) missense possibly damaging 0.53
R2074:Unc80 UTSW 1 66,718,903 (GRCm39) critical splice donor site probably null
R2088:Unc80 UTSW 1 66,629,386 (GRCm39) missense possibly damaging 0.77
R2089:Unc80 UTSW 1 66,710,874 (GRCm39) splice site probably benign
R2091:Unc80 UTSW 1 66,710,874 (GRCm39) splice site probably benign
R2139:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R2169:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R2175:Unc80 UTSW 1 66,716,514 (GRCm39) missense probably damaging 1.00
R2248:Unc80 UTSW 1 66,662,365 (GRCm39) splice site probably benign
R2255:Unc80 UTSW 1 66,657,417 (GRCm39) missense possibly damaging 0.53
R2308:Unc80 UTSW 1 66,688,156 (GRCm39) missense possibly damaging 0.53
R2484:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R2507:Unc80 UTSW 1 66,651,266 (GRCm39) missense possibly damaging 0.53
R2512:Unc80 UTSW 1 66,710,767 (GRCm39) missense possibly damaging 0.70
R2878:Unc80 UTSW 1 66,710,735 (GRCm39) critical splice acceptor site probably benign
R3040:Unc80 UTSW 1 66,678,464 (GRCm39) missense probably benign 0.33
R3104:Unc80 UTSW 1 66,662,450 (GRCm39) missense probably benign 0.33
R3402:Unc80 UTSW 1 66,549,845 (GRCm39) missense probably damaging 0.97
R3403:Unc80 UTSW 1 66,549,845 (GRCm39) missense probably damaging 0.97
R3413:Unc80 UTSW 1 66,678,464 (GRCm39) missense probably benign 0.33
R3426:Unc80 UTSW 1 66,678,464 (GRCm39) missense probably benign 0.33
R3427:Unc80 UTSW 1 66,678,464 (GRCm39) missense probably benign 0.33
R3428:Unc80 UTSW 1 66,678,464 (GRCm39) missense probably benign 0.33
R3904:Unc80 UTSW 1 66,678,455 (GRCm39) nonsense probably null
R3916:Unc80 UTSW 1 66,716,654 (GRCm39) missense probably benign 0.11
R3950:Unc80 UTSW 1 66,661,729 (GRCm39) missense possibly damaging 0.53
R4642:Unc80 UTSW 1 66,710,873 (GRCm39) splice site probably null
R4646:Unc80 UTSW 1 66,708,394 (GRCm39) missense probably benign 0.03
R4655:Unc80 UTSW 1 66,710,821 (GRCm39) missense probably benign 0.18
R4662:Unc80 UTSW 1 66,685,595 (GRCm39) missense probably benign 0.01
R4720:Unc80 UTSW 1 66,549,951 (GRCm39) missense possibly damaging 0.92
R4736:Unc80 UTSW 1 66,688,831 (GRCm39) critical splice acceptor site probably null
R4795:Unc80 UTSW 1 66,567,100 (GRCm39) missense probably damaging 0.97
R4888:Unc80 UTSW 1 66,683,606 (GRCm39) missense probably damaging 0.98
R4917:Unc80 UTSW 1 66,685,709 (GRCm39) missense possibly damaging 0.86
R4918:Unc80 UTSW 1 66,685,709 (GRCm39) missense possibly damaging 0.86
R4983:Unc80 UTSW 1 66,713,891 (GRCm39) splice site probably null
R5051:Unc80 UTSW 1 66,548,636 (GRCm39) missense probably damaging 0.96
R5111:Unc80 UTSW 1 66,567,154 (GRCm39) missense possibly damaging 0.66
R5122:Unc80 UTSW 1 66,718,749 (GRCm39) missense possibly damaging 0.53
R5260:Unc80 UTSW 1 66,685,746 (GRCm39) missense possibly damaging 0.53
R5351:Unc80 UTSW 1 66,645,672 (GRCm39) missense possibly damaging 0.73
R5387:Unc80 UTSW 1 66,569,180 (GRCm39) missense possibly damaging 0.77
R5437:Unc80 UTSW 1 66,693,737 (GRCm39) missense possibly damaging 0.96
R5525:Unc80 UTSW 1 66,645,773 (GRCm39) missense possibly damaging 0.72
R5621:Unc80 UTSW 1 66,677,202 (GRCm39) missense possibly damaging 0.53
R5690:Unc80 UTSW 1 66,679,731 (GRCm39) missense probably benign 0.08
R5762:Unc80 UTSW 1 66,732,955 (GRCm39) missense possibly damaging 0.82
R5956:Unc80 UTSW 1 66,567,123 (GRCm39) missense probably damaging 0.97
R6005:Unc80 UTSW 1 66,666,416 (GRCm39) missense possibly damaging 0.53
R6025:Unc80 UTSW 1 66,734,727 (GRCm39) missense possibly damaging 0.90
R6033:Unc80 UTSW 1 66,512,419 (GRCm39) missense possibly damaging 0.92
R6033:Unc80 UTSW 1 66,512,419 (GRCm39) missense possibly damaging 0.92
R6117:Unc80 UTSW 1 66,714,226 (GRCm39) missense possibly damaging 0.72
R6156:Unc80 UTSW 1 66,651,409 (GRCm39) missense probably benign 0.01
R6157:Unc80 UTSW 1 66,693,188 (GRCm39) nonsense probably null
R6189:Unc80 UTSW 1 66,716,630 (GRCm39) missense probably benign 0.33
R6291:Unc80 UTSW 1 66,560,756 (GRCm39) missense possibly damaging 0.82
R6367:Unc80 UTSW 1 66,711,925 (GRCm39) missense probably benign 0.33
R6598:Unc80 UTSW 1 66,507,699 (GRCm39) critical splice donor site probably null
R6724:Unc80 UTSW 1 66,722,350 (GRCm39) missense possibly damaging 0.90
R6763:Unc80 UTSW 1 66,560,636 (GRCm39) missense probably benign 0.00
R6773:Unc80 UTSW 1 66,690,702 (GRCm39) missense probably benign 0.33
R6883:Unc80 UTSW 1 66,685,563 (GRCm39) missense probably benign 0.33
R6951:Unc80 UTSW 1 66,687,670 (GRCm39) missense possibly damaging 0.53
R6965:Unc80 UTSW 1 66,685,725 (GRCm39) missense probably benign 0.33
R6993:Unc80 UTSW 1 66,588,952 (GRCm39) missense possibly damaging 0.60
R7041:Unc80 UTSW 1 66,542,752 (GRCm39) missense probably benign 0.00
R7050:Unc80 UTSW 1 66,590,067 (GRCm39) splice site probably null
R7067:Unc80 UTSW 1 66,685,731 (GRCm39) missense possibly damaging 0.86
R7080:Unc80 UTSW 1 66,685,680 (GRCm39) missense possibly damaging 0.53
R7193:Unc80 UTSW 1 66,588,943 (GRCm39) missense possibly damaging 0.60
R7197:Unc80 UTSW 1 66,560,725 (GRCm39) nonsense probably null
R7278:Unc80 UTSW 1 66,591,368 (GRCm39) missense possibly damaging 0.82
R7290:Unc80 UTSW 1 66,640,356 (GRCm39) missense probably damaging 0.97
R7391:Unc80 UTSW 1 66,734,687 (GRCm39) missense probably benign 0.18
R7401:Unc80 UTSW 1 66,685,574 (GRCm39) missense possibly damaging 0.96
R7470:Unc80 UTSW 1 66,661,621 (GRCm39) missense probably benign 0.02
R7573:Unc80 UTSW 1 66,560,696 (GRCm39) missense probably damaging 1.00
R7637:Unc80 UTSW 1 66,711,843 (GRCm39) missense possibly damaging 0.86
R7678:Unc80 UTSW 1 66,688,881 (GRCm39) missense probably benign 0.33
R7697:Unc80 UTSW 1 66,677,104 (GRCm39) missense possibly damaging 0.93
R7746:Unc80 UTSW 1 66,716,544 (GRCm39) missense probably benign 0.33
R7768:Unc80 UTSW 1 66,549,754 (GRCm39) missense possibly damaging 0.56
R7796:Unc80 UTSW 1 66,542,873 (GRCm39) missense probably benign
R7855:Unc80 UTSW 1 66,522,508 (GRCm39) missense possibly damaging 0.78
R7878:Unc80 UTSW 1 66,640,300 (GRCm39) missense possibly damaging 0.88
R7879:Unc80 UTSW 1 66,549,866 (GRCm39) missense probably benign 0.00
R8024:Unc80 UTSW 1 66,645,803 (GRCm39) missense possibly damaging 0.86
R8026:Unc80 UTSW 1 66,522,463 (GRCm39) missense possibly damaging 0.92
R8115:Unc80 UTSW 1 66,688,072 (GRCm39) missense probably benign 0.00
R8135:Unc80 UTSW 1 66,548,446 (GRCm39) missense possibly damaging 0.49
R8170:Unc80 UTSW 1 66,690,692 (GRCm39) missense probably benign 0.33
R8239:Unc80 UTSW 1 66,693,178 (GRCm39) missense probably benign
R8249:Unc80 UTSW 1 66,658,650 (GRCm39) missense probably benign 0.01
R8275:Unc80 UTSW 1 66,679,773 (GRCm39) nonsense probably null
R8288:Unc80 UTSW 1 66,512,509 (GRCm39) missense probably benign 0.07
R8341:Unc80 UTSW 1 66,688,192 (GRCm39) missense possibly damaging 0.73
R8356:Unc80 UTSW 1 66,680,788 (GRCm39) missense possibly damaging 0.85
R8433:Unc80 UTSW 1 66,677,187 (GRCm39) nonsense probably null
R8456:Unc80 UTSW 1 66,680,788 (GRCm39) missense possibly damaging 0.85
R8464:Unc80 UTSW 1 66,512,423 (GRCm39) missense probably damaging 1.00
R8483:Unc80 UTSW 1 66,732,869 (GRCm39) missense possibly damaging 0.83
R8509:Unc80 UTSW 1 66,680,788 (GRCm39) missense possibly damaging 0.85
R8686:Unc80 UTSW 1 66,651,427 (GRCm39) missense possibly damaging 0.53
R8701:Unc80 UTSW 1 66,677,191 (GRCm39) missense possibly damaging 0.85
R8729:Unc80 UTSW 1 66,647,649 (GRCm39) missense probably benign 0.01
R8755:Unc80 UTSW 1 66,651,290 (GRCm39) missense possibly damaging 0.53
R8771:Unc80 UTSW 1 66,685,554 (GRCm39) missense possibly damaging 0.85
R8866:Unc80 UTSW 1 66,629,388 (GRCm39) missense probably benign 0.05
R8942:Unc80 UTSW 1 66,512,468 (GRCm39) missense possibly damaging 0.94
R8976:Unc80 UTSW 1 66,511,169 (GRCm39) missense possibly damaging 0.87
R9063:Unc80 UTSW 1 66,645,816 (GRCm39) critical splice donor site probably null
R9095:Unc80 UTSW 1 66,545,912 (GRCm39) missense probably damaging 1.00
R9125:Unc80 UTSW 1 66,718,740 (GRCm39) missense probably benign 0.18
R9130:Unc80 UTSW 1 66,677,244 (GRCm39) missense possibly damaging 0.85
R9165:Unc80 UTSW 1 66,589,000 (GRCm39) missense probably null 0.95
R9220:Unc80 UTSW 1 66,546,534 (GRCm39) missense probably damaging 1.00
R9262:Unc80 UTSW 1 66,594,411 (GRCm39) intron probably benign
R9334:Unc80 UTSW 1 66,688,919 (GRCm39) missense possibly damaging 0.73
R9374:Unc80 UTSW 1 66,629,460 (GRCm39) missense possibly damaging 0.95
R9387:Unc80 UTSW 1 66,589,097 (GRCm39) critical splice donor site probably null
R9415:Unc80 UTSW 1 66,550,064 (GRCm39) missense
R9427:Unc80 UTSW 1 66,594,158 (GRCm39) missense probably damaging 1.00
R9436:Unc80 UTSW 1 66,732,964 (GRCm39) critical splice donor site probably null
R9454:Unc80 UTSW 1 66,734,749 (GRCm39) missense possibly damaging 0.53
R9522:Unc80 UTSW 1 66,677,221 (GRCm39) missense possibly damaging 0.73
R9539:Unc80 UTSW 1 66,609,163 (GRCm39) critical splice donor site probably null
R9552:Unc80 UTSW 1 66,717,282 (GRCm39) missense possibly damaging 0.85
R9667:Unc80 UTSW 1 66,651,287 (GRCm39) missense possibly damaging 0.86
R9720:Unc80 UTSW 1 66,683,485 (GRCm39) missense possibly damaging 0.53
R9749:Unc80 UTSW 1 66,544,179 (GRCm39) missense probably damaging 0.99
R9789:Unc80 UTSW 1 66,651,371 (GRCm39) missense possibly damaging 0.53
X0019:Unc80 UTSW 1 66,687,541 (GRCm39) missense probably benign 0.33
X0021:Unc80 UTSW 1 66,548,425 (GRCm39) critical splice acceptor site probably null
X0024:Unc80 UTSW 1 66,530,205 (GRCm39) missense probably benign 0.21
X0062:Unc80 UTSW 1 66,662,418 (GRCm39) missense probably benign 0.02
X0066:Unc80 UTSW 1 66,569,916 (GRCm39) missense possibly damaging 0.77
Y4335:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
Y4336:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
Y4338:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
Z1088:Unc80 UTSW 1 66,685,610 (GRCm39) missense possibly damaging 0.85
Z1176:Unc80 UTSW 1 66,733,568 (GRCm39) missense probably benign
Z1177:Unc80 UTSW 1 66,734,498 (GRCm39) missense probably benign 0.03
Z1177:Unc80 UTSW 1 66,685,557 (GRCm39) missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- ACATCTTTCAGCTGTGTCGC -3'
(R):5'- TTGTAACCTTTCAGCAGCCTG -3'

Sequencing Primer
(F):5'- CAGCTGTGTCGCTTACGG -3'
(R):5'- TTTCAGCAGCCTGGGAGGAG -3'
Posted On 2021-07-15