Mutagenetix > Incidental Mutations

Incidental Mutation 'R8877:Zc3h6'

676616

Institutional Source

Beutler Lab

Gene Symbol

Zc3h6

Ensembl Gene

ENSMUSG00000042851

Gene Name

zinc finger CCCH type containing 6

Synonyms

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.156) question?

Stock #

R8877 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

128967402-129018563 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 129014399 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 466 (C466*)

Ref Sequence

ENSEMBL: ENSMUSP00000105949 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110320]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000110320
AA Change: C466*

SMART Domains

Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851
AA Change: C466*

Domain	Start	End	E-Value	Type
low complexity region	8	25	N/A	INTRINSIC
coiled coil region	30	71	N/A	INTRINSIC
low complexity region	74	88	N/A	INTRINSIC
low complexity region	177	192	N/A	INTRINSIC
ZnF_C3H1	271	296	1.72e-4	SMART
ZnF_C3H1	300	325	2.51e-6	SMART
ZnF_C3H1	326	349	5.24e0	SMART
coiled coil region	351	383	N/A	INTRINSIC
low complexity region	385	400	N/A	INTRINSIC
low complexity region	493	509	N/A	INTRINSIC
low complexity region	698	707	N/A	INTRINSIC
low complexity region	784	798	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
low complexity region	876	890	N/A	INTRINSIC

Meta Mutation Damage Score

0.9756

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

100% (58/58)

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900092C05Rik	T	A	7: 12,554,777		probably null	Het
Acp2	G	A	2: 91,205,784	R109H	probably damaging	Het
Adamts8	T	C	9: 30,951,392	S298P	probably damaging	Het
Anxa7	A	G	14: 20,467,480	V157A	probably benign	Het
Arid3b	T	C	9: 57,833,621	K181E	probably damaging	Het
Armt1	A	G	10: 4,450,864	T204A	possibly damaging	Het
Brip1	A	C	11: 86,152,706	V344G	possibly damaging	Het
Ccdc40	C	T	11: 119,263,166	S1088L	probably damaging	Het
Ccdc93	A	T	1: 121,476,138	H332L	probably benign	Het
Celsr3	A	G	9: 108,829,678	D1120G	probably damaging	Het
Cep104	T	A	4: 153,993,528	I631N	probably damaging	Het
Col17a1	C	T	19: 47,648,758	A1354T	unknown	Het
Cpa2	T	C	6: 30,541,693	L10P	probably damaging	Het
Creg2	G	T	1: 39,650,693	T83K	probably benign	Het
Ddit3	T	C	10: 127,296,015	I144T	probably damaging	Het
Dmxl1	A	G	18: 49,878,225	I1150V	possibly damaging	Het
Eprs	C	T	1: 185,415,874	R1278*	probably null	Het
Esco1	A	G	18: 10,575,017	V685A	probably damaging	Het
Gid8	C	T	2: 180,716,917	A125V	probably damaging	Het
Gin1	A	G	1: 97,783,216	D208G	possibly damaging	Het
Gja10	G	A	4: 32,602,441		probably benign	Het
Gm11487	T	A	4: 73,404,231	R12*	probably null	Het
Grin2d	T	C	7: 45,854,275	I679V	probably damaging	Het
Gsto2	C	A	19: 47,884,737	R184S	probably damaging	Het
Hira	T	A	16: 18,952,104	H830Q	probably benign	Het
Hmcn1	G	A	1: 150,638,908	T3571I	probably benign	Het
Khnyn	T	C	14: 55,894,325	V568A	possibly damaging	Het
Kif13a	T	A	13: 46,801,445		probably null	Het
Larp4b	T	C	13: 9,143,799	V161A	probably benign	Het
Larp6	T	A	9: 60,737,567	M330K	probably benign	Het
Lhfp	A	G	3: 53,043,553	R83G	possibly damaging	Het
Mavs	A	G	2: 131,245,569	N329S	possibly damaging	Het
Mep1b	T	A	18: 21,088,573	N193K	possibly damaging	Het
Mttp	A	T	3: 138,112,556	D380E	probably damaging	Het
Nbeal2	G	A	9: 110,630,243	T1939I	probably damaging	Het
Nsun7	A	T	5: 66,295,951	R670*	probably null	Het
Obsl1	G	A	1: 75,496,523	R1019*	probably null	Het
Olfr1131	T	C	2: 87,628,868	M19T	probably damaging	Het
Olfr1335	A	G	4: 118,809,285	V193A	probably damaging	Het
Phc3	C	T	3: 30,914,122	V922I	probably damaging	Het
Pip5kl1	T	C	2: 32,578,939	V190A	possibly damaging	Het
Plekhg2	G	T	7: 28,360,853	T993N	possibly damaging	Het
Psg26	C	T	7: 18,483,940	V18I	probably benign	Het
Slc11a1	A	G	1: 74,380,265	Y187C	probably damaging	Het
Smarcd3	A	G	5: 24,593,992	S323P	possibly damaging	Het
Spen	G	T	4: 141,471,826	Y3163*	probably null	Het
Stx4a	T	A	7: 127,848,461	V259D	probably damaging	Het
Synj2	T	C	17: 6,037,666	S1331P	probably damaging	Het
Tmprss11c	G	A	5: 86,237,681	Q311*	probably null	Het
Tpo	T	A	12: 30,092,739	N662I	probably damaging	Het
Trav13-4-dv7	C	A	14: 53,757,893	D101E	probably damaging	Het
Trbv14	G	A	6: 41,135,358	A30T	probably benign	Het
Unc80	T	C	1: 66,527,985	S917P	possibly damaging	Het
Zfp462	T	C	4: 55,011,097	V1021A	probably damaging	Het
Zfp51	T	C	17: 21,461,755	M72T	probably damaging	Het
Zfp704	C	T	3: 9,609,356	E122K	unknown	Het
Zfyve26	T	C	12: 79,287,378	K289E	probably benign	Het

Other mutations in Zc3h6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01732:Zc3h6	APN	2	129011875	missense	probably damaging	1.00
IGL01880:Zc3h6	APN	2	129017378	missense	probably damaging	0.99
IGL02160:Zc3h6	APN	2	128997685	missense	probably benign	0.02
IGL02161:Zc3h6	APN	2	128993226	missense	possibly damaging	0.90
IGL02202:Zc3h6	APN	2	129016581	missense	probably damaging	1.00
IGL02547:Zc3h6	APN	2	129015611	missense	probably benign	0.00
IGL02973:Zc3h6	APN	2	128997795	missense	probably damaging	0.98
BB001:Zc3h6	UTSW	2	129015480	missense	possibly damaging	0.52
BB011:Zc3h6	UTSW	2	129015480	missense	possibly damaging	0.52
R0336:Zc3h6	UTSW	2	129015412	missense	possibly damaging	0.81
R0420:Zc3h6	UTSW	2	129014827	missense	probably benign	0.00
R0538:Zc3h6	UTSW	2	129017223	missense	possibly damaging	0.75
R0944:Zc3h6	UTSW	2	129006816	missense	probably damaging	1.00
R1151:Zc3h6	UTSW	2	129017136	missense	probably benign	0.00
R1528:Zc3h6	UTSW	2	129017069	missense	probably benign	0.01
R1698:Zc3h6	UTSW	2	129017358	missense	probably benign
R1712:Zc3h6	UTSW	2	129016734	missense	probably damaging	1.00
R1913:Zc3h6	UTSW	2	129016620	missense	probably damaging	1.00
R1926:Zc3h6	UTSW	2	128997795	missense	probably damaging	0.98
R2030:Zc3h6	UTSW	2	129006086	missense	probably damaging	1.00
R2051:Zc3h6	UTSW	2	129015618	missense	possibly damaging	0.55
R2133:Zc3h6	UTSW	2	128967830	missense	possibly damaging	0.53
R2273:Zc3h6	UTSW	2	129014709	missense	probably benign	0.01
R2328:Zc3h6	UTSW	2	128993202	missense	possibly damaging	0.85
R2862:Zc3h6	UTSW	2	129015460	missense	probably benign	0.43
R2899:Zc3h6	UTSW	2	129002232	missense	probably benign	0.00
R3711:Zc3h6	UTSW	2	129017331	missense	probably benign	0.00
R3743:Zc3h6	UTSW	2	128997792	missense	probably damaging	1.00
R3893:Zc3h6	UTSW	2	129016140	missense	probably damaging	1.00
R4748:Zc3h6	UTSW	2	129002240	missense	probably damaging	1.00
R5025:Zc3h6	UTSW	2	129010433	missense	possibly damaging	0.87
R5026:Zc3h6	UTSW	2	129017309	missense	probably benign	0.00
R5125:Zc3h6	UTSW	2	129014479	missense	possibly damaging	0.93
R5373:Zc3h6	UTSW	2	129002156	missense	possibly damaging	0.75
R5374:Zc3h6	UTSW	2	129002156	missense	possibly damaging	0.75
R5703:Zc3h6	UTSW	2	128993452	intron	probably benign
R5802:Zc3h6	UTSW	2	129015559	missense	possibly damaging	0.56
R5876:Zc3h6	UTSW	2	128993277	missense	probably benign	0.29
R5879:Zc3h6	UTSW	2	128997776	splice site	probably null
R5950:Zc3h6	UTSW	2	128997790	nonsense	probably null
R6031:Zc3h6	UTSW	2	128967812	missense	possibly damaging	0.85
R6031:Zc3h6	UTSW	2	128967812	missense	possibly damaging	0.85
R6781:Zc3h6	UTSW	2	129015421	missense	probably damaging	0.99
R7323:Zc3h6	UTSW	2	128993411	missense	unknown
R7340:Zc3h6	UTSW	2	128993190	missense	possibly damaging	0.90
R7572:Zc3h6	UTSW	2	129017252	missense	probably benign	0.02
R7576:Zc3h6	UTSW	2	129014553	missense	probably damaging	1.00
R7797:Zc3h6	UTSW	2	129015635	critical splice donor site	probably null
R7924:Zc3h6	UTSW	2	129015480	missense	possibly damaging	0.52
R8048:Zc3h6	UTSW	2	129017014	missense	probably benign	0.30
R9076:Zc3h6	UTSW	2	129017176	nonsense	probably null
Z1176:Zc3h6	UTSW	2	129016221	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TCTACCTGCCAATGACATGAA -3'
(R):5'- TTCAGATGAACTGGGTAGCAAA -3'

Sequencing Primer
(F):5'- TCCTGACTTCCTTCAGAGATGAACAG -3'
(R):5'- AGCAAAGATGGGTTCTCTTGC -3'

Posted On

2021-07-15