Incidental Mutation 'R8877:Zc3h6'
ID 676616
Institutional Source Beutler Lab
Gene Symbol Zc3h6
Ensembl Gene ENSMUSG00000042851
Gene Name zinc finger CCCH type containing 6
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock # R8877 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 128967402-129018563 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 129014399 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 466 (C466*)
Ref Sequence ENSEMBL: ENSMUSP00000105949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110320]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000110320
AA Change: C466*
SMART Domains Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851
AA Change: C466*

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
coiled coil region 30 71 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
ZnF_C3H1 271 296 1.72e-4 SMART
ZnF_C3H1 300 325 2.51e-6 SMART
ZnF_C3H1 326 349 5.24e0 SMART
coiled coil region 351 383 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
low complexity region 698 707 N/A INTRINSIC
low complexity region 784 798 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 876 890 N/A INTRINSIC
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T A 7: 12,554,777 probably null Het
Acp2 G A 2: 91,205,784 R109H probably damaging Het
Adamts8 T C 9: 30,951,392 S298P probably damaging Het
Anxa7 A G 14: 20,467,480 V157A probably benign Het
Arid3b T C 9: 57,833,621 K181E probably damaging Het
Armt1 A G 10: 4,450,864 T204A possibly damaging Het
Brip1 A C 11: 86,152,706 V344G possibly damaging Het
Ccdc40 C T 11: 119,263,166 S1088L probably damaging Het
Ccdc93 A T 1: 121,476,138 H332L probably benign Het
Celsr3 A G 9: 108,829,678 D1120G probably damaging Het
Cep104 T A 4: 153,993,528 I631N probably damaging Het
Col17a1 C T 19: 47,648,758 A1354T unknown Het
Cpa2 T C 6: 30,541,693 L10P probably damaging Het
Creg2 G T 1: 39,650,693 T83K probably benign Het
Ddit3 T C 10: 127,296,015 I144T probably damaging Het
Dmxl1 A G 18: 49,878,225 I1150V possibly damaging Het
Eprs C T 1: 185,415,874 R1278* probably null Het
Esco1 A G 18: 10,575,017 V685A probably damaging Het
Gid8 C T 2: 180,716,917 A125V probably damaging Het
Gin1 A G 1: 97,783,216 D208G possibly damaging Het
Gja10 G A 4: 32,602,441 probably benign Het
Gm11487 T A 4: 73,404,231 R12* probably null Het
Grin2d T C 7: 45,854,275 I679V probably damaging Het
Gsto2 C A 19: 47,884,737 R184S probably damaging Het
Hira T A 16: 18,952,104 H830Q probably benign Het
Hmcn1 G A 1: 150,638,908 T3571I probably benign Het
Khnyn T C 14: 55,894,325 V568A possibly damaging Het
Kif13a T A 13: 46,801,445 probably null Het
Larp4b T C 13: 9,143,799 V161A probably benign Het
Larp6 T A 9: 60,737,567 M330K probably benign Het
Lhfp A G 3: 53,043,553 R83G possibly damaging Het
Mavs A G 2: 131,245,569 N329S possibly damaging Het
Mep1b T A 18: 21,088,573 N193K possibly damaging Het
Mttp A T 3: 138,112,556 D380E probably damaging Het
Nbeal2 G A 9: 110,630,243 T1939I probably damaging Het
Nsun7 A T 5: 66,295,951 R670* probably null Het
Obsl1 G A 1: 75,496,523 R1019* probably null Het
Olfr1131 T C 2: 87,628,868 M19T probably damaging Het
Olfr1335 A G 4: 118,809,285 V193A probably damaging Het
Phc3 C T 3: 30,914,122 V922I probably damaging Het
Pip5kl1 T C 2: 32,578,939 V190A possibly damaging Het
Plekhg2 G T 7: 28,360,853 T993N possibly damaging Het
Psg26 C T 7: 18,483,940 V18I probably benign Het
Slc11a1 A G 1: 74,380,265 Y187C probably damaging Het
Smarcd3 A G 5: 24,593,992 S323P possibly damaging Het
Spen G T 4: 141,471,826 Y3163* probably null Het
Stx4a T A 7: 127,848,461 V259D probably damaging Het
Synj2 T C 17: 6,037,666 S1331P probably damaging Het
Tmprss11c G A 5: 86,237,681 Q311* probably null Het
Tpo T A 12: 30,092,739 N662I probably damaging Het
Trav13-4-dv7 C A 14: 53,757,893 D101E probably damaging Het
Trbv14 G A 6: 41,135,358 A30T probably benign Het
Unc80 T C 1: 66,527,985 S917P possibly damaging Het
Zfp462 T C 4: 55,011,097 V1021A probably damaging Het
Zfp51 T C 17: 21,461,755 M72T probably damaging Het
Zfp704 C T 3: 9,609,356 E122K unknown Het
Zfyve26 T C 12: 79,287,378 K289E probably benign Het
Other mutations in Zc3h6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Zc3h6 APN 2 129011875 missense probably damaging 1.00
IGL01880:Zc3h6 APN 2 129017378 missense probably damaging 0.99
IGL02160:Zc3h6 APN 2 128997685 missense probably benign 0.02
IGL02161:Zc3h6 APN 2 128993226 missense possibly damaging 0.90
IGL02202:Zc3h6 APN 2 129016581 missense probably damaging 1.00
IGL02547:Zc3h6 APN 2 129015611 missense probably benign 0.00
IGL02973:Zc3h6 APN 2 128997795 missense probably damaging 0.98
BB001:Zc3h6 UTSW 2 129015480 missense possibly damaging 0.52
BB011:Zc3h6 UTSW 2 129015480 missense possibly damaging 0.52
R0336:Zc3h6 UTSW 2 129015412 missense possibly damaging 0.81
R0420:Zc3h6 UTSW 2 129014827 missense probably benign 0.00
R0538:Zc3h6 UTSW 2 129017223 missense possibly damaging 0.75
R0944:Zc3h6 UTSW 2 129006816 missense probably damaging 1.00
R1151:Zc3h6 UTSW 2 129017136 missense probably benign 0.00
R1528:Zc3h6 UTSW 2 129017069 missense probably benign 0.01
R1698:Zc3h6 UTSW 2 129017358 missense probably benign
R1712:Zc3h6 UTSW 2 129016734 missense probably damaging 1.00
R1913:Zc3h6 UTSW 2 129016620 missense probably damaging 1.00
R1926:Zc3h6 UTSW 2 128997795 missense probably damaging 0.98
R2030:Zc3h6 UTSW 2 129006086 missense probably damaging 1.00
R2051:Zc3h6 UTSW 2 129015618 missense possibly damaging 0.55
R2133:Zc3h6 UTSW 2 128967830 missense possibly damaging 0.53
R2273:Zc3h6 UTSW 2 129014709 missense probably benign 0.01
R2328:Zc3h6 UTSW 2 128993202 missense possibly damaging 0.85
R2862:Zc3h6 UTSW 2 129015460 missense probably benign 0.43
R2899:Zc3h6 UTSW 2 129002232 missense probably benign 0.00
R3711:Zc3h6 UTSW 2 129017331 missense probably benign 0.00
R3743:Zc3h6 UTSW 2 128997792 missense probably damaging 1.00
R3893:Zc3h6 UTSW 2 129016140 missense probably damaging 1.00
R4748:Zc3h6 UTSW 2 129002240 missense probably damaging 1.00
R5025:Zc3h6 UTSW 2 129010433 missense possibly damaging 0.87
R5026:Zc3h6 UTSW 2 129017309 missense probably benign 0.00
R5125:Zc3h6 UTSW 2 129014479 missense possibly damaging 0.93
R5373:Zc3h6 UTSW 2 129002156 missense possibly damaging 0.75
R5374:Zc3h6 UTSW 2 129002156 missense possibly damaging 0.75
R5703:Zc3h6 UTSW 2 128993452 intron probably benign
R5802:Zc3h6 UTSW 2 129015559 missense possibly damaging 0.56
R5876:Zc3h6 UTSW 2 128993277 missense probably benign 0.29
R5879:Zc3h6 UTSW 2 128997776 splice site probably null
R5950:Zc3h6 UTSW 2 128997790 nonsense probably null
R6031:Zc3h6 UTSW 2 128967812 missense possibly damaging 0.85
R6031:Zc3h6 UTSW 2 128967812 missense possibly damaging 0.85
R6781:Zc3h6 UTSW 2 129015421 missense probably damaging 0.99
R7323:Zc3h6 UTSW 2 128993411 missense unknown
R7340:Zc3h6 UTSW 2 128993190 missense possibly damaging 0.90
R7572:Zc3h6 UTSW 2 129017252 missense probably benign 0.02
R7576:Zc3h6 UTSW 2 129014553 missense probably damaging 1.00
R7797:Zc3h6 UTSW 2 129015635 critical splice donor site probably null
R7924:Zc3h6 UTSW 2 129015480 missense possibly damaging 0.52
R8048:Zc3h6 UTSW 2 129017014 missense probably benign 0.30
R9076:Zc3h6 UTSW 2 129017176 nonsense probably null
Z1176:Zc3h6 UTSW 2 129016221 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTACCTGCCAATGACATGAA -3'
(R):5'- TTCAGATGAACTGGGTAGCAAA -3'

Sequencing Primer
(F):5'- TCCTGACTTCCTTCAGAGATGAACAG -3'
(R):5'- AGCAAAGATGGGTTCTCTTGC -3'
Posted On 2021-07-15