Incidental Mutation 'R8877:Spen'
ID 676627
Institutional Source Beutler Lab
Gene Symbol Spen
Ensembl Gene ENSMUSG00000040761
Gene Name spen family transcription repressor
Synonyms Mint
MMRRC Submission 068745-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8877 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 141195201-141265908 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 141199137 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 3163 (Y3163*)
Ref Sequence ENSEMBL: ENSMUSP00000101412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006377] [ENSMUST00000078886] [ENSMUST00000105786]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000006377
SMART Domains Protein: ENSMUSP00000006377
Gene: ENSMUSG00000006215

DomainStartEndE-ValueType
BTB 24 116 1.38e-27 SMART
low complexity region 203 222 N/A INTRINSIC
ZnF_C2H2 297 319 6.42e-4 SMART
ZnF_C2H2 325 347 3.11e-2 SMART
ZnF_C2H2 353 375 2.49e-1 SMART
ZnF_C2H2 381 403 8.47e-4 SMART
ZnF_C2H2 409 431 8.47e-4 SMART
ZnF_C2H2 437 459 1.22e-4 SMART
ZnF_C2H2 465 487 4.94e-5 SMART
ZnF_C2H2 493 515 3.26e-5 SMART
ZnF_C2H2 521 543 7.26e-3 SMART
ZnF_C2H2 549 571 4.79e-3 SMART
ZnF_C2H2 577 599 1.58e-3 SMART
ZnF_C2H2 605 628 2.57e-3 SMART
low complexity region 654 674 N/A INTRINSIC
ZnF_C2H2 708 730 4.4e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000078886
AA Change: Y3140*
SMART Domains Protein: ENSMUSP00000077925
Gene: ENSMUSG00000040761
AA Change: Y3140*

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 617 632 N/A INTRINSIC
low complexity region 669 691 N/A INTRINSIC
low complexity region 695 720 N/A INTRINSIC
low complexity region 749 773 N/A INTRINSIC
coiled coil region 800 825 N/A INTRINSIC
low complexity region 830 841 N/A INTRINSIC
internal_repeat_2 844 954 6.27e-5 PROSPERO
coiled coil region 1494 1522 N/A INTRINSIC
low complexity region 1587 1627 N/A INTRINSIC
low complexity region 1635 1641 N/A INTRINSIC
low complexity region 1642 1671 N/A INTRINSIC
low complexity region 1747 1758 N/A INTRINSIC
low complexity region 1810 1823 N/A INTRINSIC
low complexity region 1888 1903 N/A INTRINSIC
low complexity region 1940 1955 N/A INTRINSIC
low complexity region 2003 2012 N/A INTRINSIC
internal_repeat_2 2015 2115 6.27e-5 PROSPERO
low complexity region 2127 2147 N/A INTRINSIC
low complexity region 2169 2191 N/A INTRINSIC
low complexity region 2207 2219 N/A INTRINSIC
low complexity region 2304 2323 N/A INTRINSIC
low complexity region 2332 2371 N/A INTRINSIC
low complexity region 2396 2413 N/A INTRINSIC
low complexity region 2518 2533 N/A INTRINSIC
low complexity region 2545 2555 N/A INTRINSIC
low complexity region 2696 2722 N/A INTRINSIC
low complexity region 2931 2942 N/A INTRINSIC
low complexity region 2994 3006 N/A INTRINSIC
low complexity region 3192 3212 N/A INTRINSIC
low complexity region 3299 3337 N/A INTRINSIC
Pfam:SPOC 3465 3586 2.7e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105786
AA Change: Y3163*
SMART Domains Protein: ENSMUSP00000101412
Gene: ENSMUSG00000040761
AA Change: Y3163*

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 692 714 N/A INTRINSIC
low complexity region 718 743 N/A INTRINSIC
low complexity region 772 796 N/A INTRINSIC
coiled coil region 823 848 N/A INTRINSIC
low complexity region 853 864 N/A INTRINSIC
internal_repeat_2 867 977 8.58e-5 PROSPERO
coiled coil region 1517 1545 N/A INTRINSIC
low complexity region 1610 1650 N/A INTRINSIC
low complexity region 1658 1664 N/A INTRINSIC
low complexity region 1665 1694 N/A INTRINSIC
low complexity region 1770 1781 N/A INTRINSIC
low complexity region 1833 1846 N/A INTRINSIC
low complexity region 1911 1926 N/A INTRINSIC
low complexity region 1963 1978 N/A INTRINSIC
low complexity region 2026 2035 N/A INTRINSIC
internal_repeat_2 2038 2138 8.58e-5 PROSPERO
low complexity region 2150 2170 N/A INTRINSIC
low complexity region 2192 2214 N/A INTRINSIC
low complexity region 2230 2242 N/A INTRINSIC
low complexity region 2327 2346 N/A INTRINSIC
low complexity region 2355 2394 N/A INTRINSIC
low complexity region 2419 2436 N/A INTRINSIC
low complexity region 2541 2556 N/A INTRINSIC
low complexity region 2568 2578 N/A INTRINSIC
low complexity region 2719 2745 N/A INTRINSIC
low complexity region 2954 2965 N/A INTRINSIC
low complexity region 3017 3029 N/A INTRINSIC
low complexity region 3215 3235 N/A INTRINSIC
low complexity region 3322 3360 N/A INTRINSIC
Pfam:SPOC 3488 3609 2.7e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hormone inducible transcriptional repressor. Repression of transcription by this gene product can occur through interactions with other repressors, by the recruitment of proteins involved in histone deacetylation, or through sequestration of transcriptional activators. The product of this gene contains a carboxy-terminal domain that permits binding to other corepressor proteins. This domain also permits interaction with members of the NuRD complex, a nucleosome remodeling protein complex that contains deacetylase activity. In addition, this repressor contains several RNA recognition motifs that confer binding to a steroid receptor RNA coactivator; this binding can modulate the activity of both liganded and nonliganded steroid receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during late gestation exhibiting morphological abnormalities of the heart, pancreas, and liver. Inactivation of this gene also affects the differentiation of B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T A 7: 12,288,704 (GRCm39) probably null Het
Acp2 G A 2: 91,036,129 (GRCm39) R109H probably damaging Het
Adamts8 T C 9: 30,862,688 (GRCm39) S298P probably damaging Het
Anxa7 A G 14: 20,517,548 (GRCm39) V157A probably benign Het
Arid3b T C 9: 57,740,904 (GRCm39) K181E probably damaging Het
Armt1 A G 10: 4,400,864 (GRCm39) T204A possibly damaging Het
Brip1 A C 11: 86,043,532 (GRCm39) V344G possibly damaging Het
Ccdc40 C T 11: 119,153,992 (GRCm39) S1088L probably damaging Het
Ccdc93 A T 1: 121,403,867 (GRCm39) H332L probably benign Het
Celsr3 A G 9: 108,706,877 (GRCm39) D1120G probably damaging Het
Cep104 T A 4: 154,077,985 (GRCm39) I631N probably damaging Het
Col17a1 C T 19: 47,637,197 (GRCm39) A1354T unknown Het
Cpa2 T C 6: 30,541,692 (GRCm39) L10P probably damaging Het
Creg2 G T 1: 39,689,861 (GRCm39) T83K probably benign Het
Ddit3 T C 10: 127,131,884 (GRCm39) I144T probably damaging Het
Dmxl1 A G 18: 50,011,292 (GRCm39) I1150V possibly damaging Het
Eprs1 C T 1: 185,148,071 (GRCm39) R1278* probably null Het
Esco1 A G 18: 10,575,017 (GRCm39) V685A probably damaging Het
Gid8 C T 2: 180,358,710 (GRCm39) A125V probably damaging Het
Gin1 A G 1: 97,710,941 (GRCm39) D208G possibly damaging Het
Gja10 G A 4: 32,602,441 (GRCm39) probably benign Het
Grin2d T C 7: 45,503,699 (GRCm39) I679V probably damaging Het
Gsto2 C A 19: 47,873,176 (GRCm39) R184S probably damaging Het
Hira T A 16: 18,770,854 (GRCm39) H830Q probably benign Het
Hmcn1 G A 1: 150,514,659 (GRCm39) T3571I probably benign Het
Khnyn T C 14: 56,131,782 (GRCm39) V568A possibly damaging Het
Kif13a T A 13: 46,954,921 (GRCm39) probably null Het
Larp4b T C 13: 9,193,835 (GRCm39) V161A probably benign Het
Larp6 T A 9: 60,644,850 (GRCm39) M330K probably benign Het
Lhfpl6 A G 3: 52,950,974 (GRCm39) R83G possibly damaging Het
Mavs A G 2: 131,087,489 (GRCm39) N329S possibly damaging Het
Mep1b T A 18: 21,221,630 (GRCm39) N193K possibly damaging Het
Msantd5f6 T A 4: 73,322,468 (GRCm39) R12* probably null Het
Mttp A T 3: 137,818,317 (GRCm39) D380E probably damaging Het
Nbeal2 G A 9: 110,459,311 (GRCm39) T1939I probably damaging Het
Nsun7 A T 5: 66,453,294 (GRCm39) R670* probably null Het
Obsl1 G A 1: 75,473,167 (GRCm39) R1019* probably null Het
Or10ak12 A G 4: 118,666,482 (GRCm39) V193A probably damaging Het
Or5w11 T C 2: 87,459,212 (GRCm39) M19T probably damaging Het
Phc3 C T 3: 30,968,271 (GRCm39) V922I probably damaging Het
Pip5kl1 T C 2: 32,468,951 (GRCm39) V190A possibly damaging Het
Plekhg2 G T 7: 28,060,278 (GRCm39) T993N possibly damaging Het
Psg26 C T 7: 18,217,865 (GRCm39) V18I probably benign Het
Slc11a1 A G 1: 74,419,424 (GRCm39) Y187C probably damaging Het
Smarcd3 A G 5: 24,798,990 (GRCm39) S323P possibly damaging Het
Stx4a T A 7: 127,447,633 (GRCm39) V259D probably damaging Het
Synj2 T C 17: 6,087,941 (GRCm39) S1331P probably damaging Het
Tmprss11c G A 5: 86,385,540 (GRCm39) Q311* probably null Het
Tpo T A 12: 30,142,738 (GRCm39) N662I probably damaging Het
Trav13d-4 C A 14: 53,995,350 (GRCm39) D101E probably damaging Het
Trbv14 G A 6: 41,112,292 (GRCm39) A30T probably benign Het
Unc80 T C 1: 66,567,144 (GRCm39) S917P possibly damaging Het
Zc3h6 T A 2: 128,856,319 (GRCm39) C466* probably null Het
Zfp462 T C 4: 55,011,097 (GRCm39) V1021A probably damaging Het
Zfp51 T C 17: 21,682,017 (GRCm39) M72T probably damaging Het
Zfp704 C T 3: 9,674,416 (GRCm39) E122K unknown Het
Zfyve26 T C 12: 79,334,152 (GRCm39) K289E probably benign Het
Other mutations in Spen
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Spen APN 4 141,217,212 (GRCm39) missense unknown
IGL01357:Spen APN 4 141,244,424 (GRCm39) missense unknown
IGL02184:Spen APN 4 141,214,917 (GRCm39) missense unknown
IGL02226:Spen APN 4 141,205,457 (GRCm39) missense unknown
IGL02321:Spen APN 4 141,244,441 (GRCm39) missense unknown
IGL02350:Spen APN 4 141,204,890 (GRCm39) missense unknown
IGL02357:Spen APN 4 141,204,890 (GRCm39) missense unknown
IGL02627:Spen APN 4 141,200,326 (GRCm39) missense probably damaging 0.99
IGL02683:Spen APN 4 141,198,956 (GRCm39) missense probably benign 0.06
IGL02945:Spen APN 4 141,221,624 (GRCm39) missense unknown
IGL02950:Spen APN 4 141,196,819 (GRCm39) missense probably damaging 1.00
IGL03008:Spen APN 4 141,203,448 (GRCm39) missense possibly damaging 0.70
IGL03019:Spen APN 4 141,206,227 (GRCm39) missense unknown
IGL03038:Spen APN 4 141,265,550 (GRCm39) missense unknown
IGL03334:Spen APN 4 141,197,280 (GRCm39) missense probably damaging 1.00
filtered UTSW 4 141,204,683 (GRCm39) missense unknown
mentholated UTSW 4 141,196,711 (GRCm39) missense possibly damaging 0.78
R0105:Spen UTSW 4 141,197,121 (GRCm39) splice site probably benign
R0268:Spen UTSW 4 141,204,868 (GRCm39) missense unknown
R0359:Spen UTSW 4 141,244,181 (GRCm39) missense unknown
R0394:Spen UTSW 4 141,201,514 (GRCm39) missense probably benign 0.03
R0423:Spen UTSW 4 141,206,647 (GRCm39) missense unknown
R0433:Spen UTSW 4 141,211,069 (GRCm39) missense unknown
R0462:Spen UTSW 4 141,200,962 (GRCm39) missense probably damaging 1.00
R0687:Spen UTSW 4 141,215,339 (GRCm39) missense unknown
R0699:Spen UTSW 4 141,201,702 (GRCm39) missense possibly damaging 0.72
R0865:Spen UTSW 4 141,199,181 (GRCm39) missense probably benign 0.11
R0918:Spen UTSW 4 141,212,875 (GRCm39) missense unknown
R1034:Spen UTSW 4 141,203,063 (GRCm39) missense probably benign 0.33
R1341:Spen UTSW 4 141,196,711 (GRCm39) missense possibly damaging 0.78
R1401:Spen UTSW 4 141,199,132 (GRCm39) missense probably damaging 0.98
R1509:Spen UTSW 4 141,202,946 (GRCm39) missense probably benign 0.00
R1509:Spen UTSW 4 141,203,011 (GRCm39) missense possibly damaging 0.53
R1561:Spen UTSW 4 141,199,694 (GRCm39) nonsense probably null
R1589:Spen UTSW 4 141,215,335 (GRCm39) missense unknown
R1640:Spen UTSW 4 141,196,254 (GRCm39) missense probably damaging 0.98
R1758:Spen UTSW 4 141,203,686 (GRCm39) missense unknown
R1764:Spen UTSW 4 141,200,261 (GRCm39) missense probably damaging 1.00
R1824:Spen UTSW 4 141,200,096 (GRCm39) missense probably damaging 1.00
R1899:Spen UTSW 4 141,197,654 (GRCm39) missense probably benign 0.17
R1916:Spen UTSW 4 141,199,909 (GRCm39) missense probably damaging 1.00
R2011:Spen UTSW 4 141,200,640 (GRCm39) missense probably damaging 1.00
R2295:Spen UTSW 4 141,204,584 (GRCm39) missense unknown
R2379:Spen UTSW 4 141,244,238 (GRCm39) missense unknown
R2404:Spen UTSW 4 141,205,216 (GRCm39) missense unknown
R3719:Spen UTSW 4 141,244,494 (GRCm39) missense unknown
R3889:Spen UTSW 4 141,205,192 (GRCm39) missense unknown
R3945:Spen UTSW 4 141,204,664 (GRCm39) missense unknown
R4227:Spen UTSW 4 141,249,458 (GRCm39) missense unknown
R4326:Spen UTSW 4 141,204,683 (GRCm39) missense unknown
R4382:Spen UTSW 4 141,200,450 (GRCm39) missense possibly damaging 0.88
R4542:Spen UTSW 4 141,204,097 (GRCm39) missense unknown
R4757:Spen UTSW 4 141,200,390 (GRCm39) nonsense probably null
R4771:Spen UTSW 4 141,199,907 (GRCm39) missense probably benign 0.14
R5072:Spen UTSW 4 141,249,613 (GRCm39) missense unknown
R5121:Spen UTSW 4 141,203,410 (GRCm39) missense probably benign 0.00
R5176:Spen UTSW 4 141,203,587 (GRCm39) missense unknown
R5290:Spen UTSW 4 141,201,127 (GRCm39) missense probably damaging 1.00
R5291:Spen UTSW 4 141,215,390 (GRCm39) missense unknown
R5293:Spen UTSW 4 141,199,717 (GRCm39) missense possibly damaging 0.89
R5347:Spen UTSW 4 141,198,796 (GRCm39) missense probably benign 0.26
R5511:Spen UTSW 4 141,244,149 (GRCm39) missense unknown
R5511:Spen UTSW 4 141,202,375 (GRCm39) missense possibly damaging 0.86
R5772:Spen UTSW 4 141,205,495 (GRCm39) missense unknown
R5834:Spen UTSW 4 141,199,154 (GRCm39) missense possibly damaging 0.63
R5858:Spen UTSW 4 141,201,182 (GRCm39) missense probably benign 0.05
R6214:Spen UTSW 4 141,206,423 (GRCm39) missense unknown
R6232:Spen UTSW 4 141,244,333 (GRCm39) missense unknown
R6345:Spen UTSW 4 141,198,944 (GRCm39) missense possibly damaging 0.86
R6419:Spen UTSW 4 141,203,621 (GRCm39) missense unknown
R6455:Spen UTSW 4 141,202,820 (GRCm39) missense probably damaging 0.97
R6979:Spen UTSW 4 141,205,374 (GRCm39) missense unknown
R6994:Spen UTSW 4 141,220,770 (GRCm39) missense unknown
R7018:Spen UTSW 4 141,220,755 (GRCm39) missense unknown
R7040:Spen UTSW 4 141,221,693 (GRCm39) missense unknown
R7127:Spen UTSW 4 141,203,419 (GRCm39) missense possibly damaging 0.53
R7218:Spen UTSW 4 141,199,961 (GRCm39) missense possibly damaging 0.54
R7234:Spen UTSW 4 141,206,446 (GRCm39) missense unknown
R7316:Spen UTSW 4 141,204,365 (GRCm39) missense unknown
R7350:Spen UTSW 4 141,206,696 (GRCm39) missense unknown
R7356:Spen UTSW 4 141,199,235 (GRCm39) nonsense probably null
R7400:Spen UTSW 4 141,201,052 (GRCm39) missense probably damaging 1.00
R7470:Spen UTSW 4 141,206,605 (GRCm39) missense unknown
R7698:Spen UTSW 4 141,200,156 (GRCm39) missense probably damaging 1.00
R7858:Spen UTSW 4 141,215,442 (GRCm39) splice site probably null
R8033:Spen UTSW 4 141,199,057 (GRCm39) missense probably benign 0.03
R8064:Spen UTSW 4 141,203,011 (GRCm39) missense possibly damaging 0.53
R8159:Spen UTSW 4 141,202,314 (GRCm39) missense possibly damaging 0.53
R8187:Spen UTSW 4 141,200,216 (GRCm39) missense possibly damaging 0.93
R8463:Spen UTSW 4 141,249,590 (GRCm39) missense unknown
R8557:Spen UTSW 4 141,197,681 (GRCm39) missense probably benign 0.14
R8558:Spen UTSW 4 141,197,681 (GRCm39) missense probably benign 0.14
R8672:Spen UTSW 4 141,197,681 (GRCm39) missense probably benign 0.14
R8673:Spen UTSW 4 141,197,681 (GRCm39) missense probably benign 0.14
R8674:Spen UTSW 4 141,197,681 (GRCm39) missense probably benign 0.14
R8714:Spen UTSW 4 141,215,314 (GRCm39) missense unknown
R8735:Spen UTSW 4 141,197,129 (GRCm39) missense probably benign 0.32
R8762:Spen UTSW 4 141,200,261 (GRCm39) missense probably damaging 1.00
R8878:Spen UTSW 4 141,204,520 (GRCm39) missense unknown
R8937:Spen UTSW 4 141,201,374 (GRCm39) missense probably damaging 1.00
R8939:Spen UTSW 4 141,202,969 (GRCm39) missense possibly damaging 0.72
R8968:Spen UTSW 4 141,197,701 (GRCm39) missense probably benign 0.02
R8971:Spen UTSW 4 141,201,889 (GRCm39) missense possibly damaging 0.53
R9016:Spen UTSW 4 141,200,938 (GRCm39) missense probably damaging 1.00
R9072:Spen UTSW 4 141,203,702 (GRCm39) missense unknown
R9073:Spen UTSW 4 141,203,702 (GRCm39) missense unknown
R9120:Spen UTSW 4 141,200,233 (GRCm39) missense
R9136:Spen UTSW 4 141,249,623 (GRCm39) missense unknown
R9138:Spen UTSW 4 141,196,797 (GRCm39) missense probably damaging 1.00
R9150:Spen UTSW 4 141,244,468 (GRCm39) missense unknown
R9225:Spen UTSW 4 141,202,943 (GRCm39) missense possibly damaging 0.53
R9492:Spen UTSW 4 141,199,098 (GRCm39) missense probably benign 0.26
R9537:Spen UTSW 4 141,244,156 (GRCm39) small deletion probably benign
R9537:Spen UTSW 4 141,199,015 (GRCm39) missense probably benign 0.15
R9602:Spen UTSW 4 141,205,183 (GRCm39) missense unknown
R9609:Spen UTSW 4 141,215,419 (GRCm39) missense unknown
R9686:Spen UTSW 4 141,199,946 (GRCm39) missense probably benign 0.27
R9697:Spen UTSW 4 141,196,275 (GRCm39) missense probably damaging 1.00
R9713:Spen UTSW 4 141,244,331 (GRCm39) missense unknown
T0722:Spen UTSW 4 141,201,664 (GRCm39) missense probably benign 0.33
T0975:Spen UTSW 4 141,201,664 (GRCm39) missense probably benign 0.33
Z1088:Spen UTSW 4 141,205,287 (GRCm39) missense unknown
Z1088:Spen UTSW 4 141,205,288 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AGAATGCGGGCTTCACCATG -3'
(R):5'- GACAGTGTCTCTAGGTCACCTGTC -3'

Sequencing Primer
(F):5'- TTCACCATGAGGGGGCG -3'
(R):5'- TGCAGCCCCAGCAGATAGAG -3'
Posted On 2021-07-15