Incidental Mutation 'R8877:Adamts8'
ID676640
Institutional Source Beutler Lab
Gene Symbol Adamts8
Ensembl Gene ENSMUSG00000031994
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 8
SynonymsMETH-2, METH2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R8877 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location30942562-30963838 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30951392 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 298 (S298P)
Ref Sequence ENSEMBL: ENSMUSP00000069644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068135] [ENSMUST00000163037]
Predicted Effect probably damaging
Transcript: ENSMUST00000068135
AA Change: S298P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069644
Gene: ENSMUSG00000031994
AA Change: S298P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Pep_M12B_propep 35 152 6.4e-23 PFAM
Pfam:Reprolysin_5 232 418 1.3e-15 PFAM
Pfam:Reprolysin_4 233 435 3.4e-8 PFAM
Pfam:Reprolysin 234 444 3.8e-21 PFAM
Pfam:Reprolysin_2 252 434 1.3e-10 PFAM
Pfam:Reprolysin_3 255 389 7.4e-14 PFAM
TSP1 545 597 7.04e-14 SMART
Pfam:ADAM_spacer1 706 825 3.2e-35 PFAM
TSP1 851 904 5.35e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163037
AA Change: S91P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124848
Gene: ENSMUSG00000031994
AA Change: S91P

DomainStartEndE-ValueType
PDB:2V4B|B 22 128 2e-38 PDB
SCOP:d1kufa_ 27 128 2e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is expressed in mouse lung, heart and macrophage-rich areas of atherosclerotic plaques. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. This gene is located adjacent to a related ADAMTS gene on chromosome 9. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T A 7: 12,554,777 probably null Het
Acp2 G A 2: 91,205,784 R109H probably damaging Het
Anxa7 A G 14: 20,467,480 V157A probably benign Het
Arid3b T C 9: 57,833,621 K181E probably damaging Het
Armt1 A G 10: 4,450,864 T204A possibly damaging Het
Brip1 A C 11: 86,152,706 V344G possibly damaging Het
Ccdc40 C T 11: 119,263,166 S1088L probably damaging Het
Ccdc93 A T 1: 121,476,138 H332L probably benign Het
Celsr3 A G 9: 108,829,678 D1120G probably damaging Het
Cep104 T A 4: 153,993,528 I631N probably damaging Het
Col17a1 C T 19: 47,648,758 A1354T unknown Het
Cpa2 T C 6: 30,541,693 L10P probably damaging Het
Creg2 G T 1: 39,650,693 T83K probably benign Het
Ddit3 T C 10: 127,296,015 I144T probably damaging Het
Dmxl1 A G 18: 49,878,225 I1150V possibly damaging Het
Eprs C T 1: 185,415,874 R1278* probably null Het
Esco1 A G 18: 10,575,017 V685A probably damaging Het
Gid8 C T 2: 180,716,917 A125V probably damaging Het
Gin1 A G 1: 97,783,216 D208G possibly damaging Het
Gja10 G A 4: 32,602,441 probably benign Het
Gm11487 T A 4: 73,404,231 R12* probably null Het
Grin2d T C 7: 45,854,275 I679V probably damaging Het
Gsto2 C A 19: 47,884,737 R184S probably damaging Het
Hira T A 16: 18,952,104 H830Q probably benign Het
Hmcn1 G A 1: 150,638,908 T3571I probably benign Het
Khnyn T C 14: 55,894,325 V568A possibly damaging Het
Kif13a T A 13: 46,801,445 probably null Het
Larp4b T C 13: 9,143,799 V161A probably benign Het
Larp6 T A 9: 60,737,567 M330K probably benign Het
Lhfp A G 3: 53,043,553 R83G possibly damaging Het
Mavs A G 2: 131,245,569 N329S possibly damaging Het
Mep1b T A 18: 21,088,573 N193K possibly damaging Het
Mttp A T 3: 138,112,556 D380E probably damaging Het
Nbeal2 G A 9: 110,630,243 T1939I probably damaging Het
Nsun7 A T 5: 66,295,951 R670* probably null Het
Obsl1 G A 1: 75,496,523 R1019* probably null Het
Olfr1131 T C 2: 87,628,868 M19T probably damaging Het
Olfr1335 A G 4: 118,809,285 V193A probably damaging Het
Phc3 C T 3: 30,914,122 V922I probably damaging Het
Pip5kl1 T C 2: 32,578,939 V190A possibly damaging Het
Plekhg2 G T 7: 28,360,853 T993N possibly damaging Het
Psg26 C T 7: 18,483,940 V18I probably benign Het
Sbsn GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA 7: 30,752,966 probably benign Het
Slc11a1 A G 1: 74,380,265 Y187C probably damaging Het
Smarcd3 A G 5: 24,593,992 S323P possibly damaging Het
Spen G T 4: 141,471,826 Y3163* probably null Het
Stx4a T A 7: 127,848,461 V259D probably damaging Het
Synj2 T C 17: 6,037,666 S1331P probably damaging Het
Tmprss11c G A 5: 86,237,681 Q311* probably null Het
Tpo T A 12: 30,092,739 N662I probably damaging Het
Trav13-4-dv7 C A 14: 53,757,893 D101E probably damaging Het
Trbv14 G A 6: 41,135,358 A30T probably benign Het
Unc80 T C 1: 66,527,985 S917P possibly damaging Het
Zc3h6 T A 2: 129,014,399 C466* probably null Het
Zfp462 T C 4: 55,011,097 V1021A probably damaging Het
Zfp51 T C 17: 21,461,755 M72T probably damaging Het
Zfp704 C T 3: 9,609,356 E122K unknown Het
Zfyve26 T C 12: 79,287,378 K289E probably benign Het
Other mutations in Adamts8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Adamts8 APN 9 30953500 missense probably damaging 1.00
IGL02049:Adamts8 APN 9 30951354 missense probably damaging 0.96
IGL02304:Adamts8 APN 9 30956656 missense possibly damaging 0.55
IGL02385:Adamts8 APN 9 30961730 missense probably benign 0.10
IGL02536:Adamts8 APN 9 30962072 missense probably benign 0.05
IGL03347:Adamts8 APN 9 30959238 missense possibly damaging 0.75
R0633:Adamts8 UTSW 9 30943511 missense probably damaging 1.00
R1066:Adamts8 UTSW 9 30956541 missense probably damaging 1.00
R1464:Adamts8 UTSW 9 30951377 missense probably benign
R1464:Adamts8 UTSW 9 30951377 missense probably benign
R1560:Adamts8 UTSW 9 30956667 missense probably damaging 1.00
R1592:Adamts8 UTSW 9 30943176 missense probably damaging 0.99
R1753:Adamts8 UTSW 9 30954614 missense probably benign 0.04
R1932:Adamts8 UTSW 9 30956512 missense probably benign
R2087:Adamts8 UTSW 9 30962112 missense probably damaging 1.00
R2118:Adamts8 UTSW 9 30943063 missense probably damaging 1.00
R3789:Adamts8 UTSW 9 30959292 missense probably damaging 1.00
R4165:Adamts8 UTSW 9 30951388 missense probably benign 0.01
R4166:Adamts8 UTSW 9 30951388 missense probably benign 0.01
R4193:Adamts8 UTSW 9 30959308 missense probably damaging 1.00
R4425:Adamts8 UTSW 9 30956656 missense possibly damaging 0.55
R5155:Adamts8 UTSW 9 30954548 missense probably benign 0.33
R5433:Adamts8 UTSW 9 30961716 missense probably benign 0.01
R5544:Adamts8 UTSW 9 30952703 missense probably damaging 1.00
R5590:Adamts8 UTSW 9 30951336 missense probably damaging 0.97
R5640:Adamts8 UTSW 9 30956500 missense probably benign 0.00
R5800:Adamts8 UTSW 9 30954482 missense probably damaging 1.00
R5909:Adamts8 UTSW 9 30961928 missense probably benign 0.00
R6821:Adamts8 UTSW 9 30956626 missense probably benign 0.08
R6967:Adamts8 UTSW 9 30954491 missense probably benign 0.04
R7336:Adamts8 UTSW 9 30962067 missense probably benign 0.00
R7538:Adamts8 UTSW 9 30953470 missense probably damaging 1.00
R7540:Adamts8 UTSW 9 30959064 missense probably damaging 0.96
R7942:Adamts8 UTSW 9 30953482 missense probably damaging 1.00
R7942:Adamts8 UTSW 9 30958913 critical splice acceptor site probably null
R8085:Adamts8 UTSW 9 30943315 missense probably benign 0.01
R8795:Adamts8 UTSW 9 30943188 missense probably benign 0.00
R8900:Adamts8 UTSW 9 30954634 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGTCTCCTAATGAGGTGGTAG -3'
(R):5'- ATGTTTGGGCAGGCTCCAAAG -3'

Sequencing Primer
(F):5'- TGGTAGGAGTGGGCAGCC -3'
(R):5'- AAAGCCCTCCCTTTGATCTG -3'
Posted On2021-07-15