Incidental Mutation 'R8878:Fam129b'
ID676672
Institutional Source Beutler Lab
Gene Symbol Fam129b
Ensembl Gene ENSMUSG00000026796
Gene Namefamily with sequence similarity 129, member B
Synonyms9130404D14Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R8878 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location32876114-32925254 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32921093 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 372 (M372L)
Ref Sequence ENSEMBL: ENSMUSP00000028135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028132] [ENSMUST00000028135] [ENSMUST00000113200]
Predicted Effect probably benign
Transcript: ENSMUST00000028132
SMART Domains Protein: ENSMUSP00000028132
Gene: ENSMUSG00000026792

DomainStartEndE-ValueType
LRR 80 102 1.26e1 SMART
LRR 103 125 9.3e-1 SMART
LRR 126 148 1.91e1 SMART
LRR 149 171 7.05e-1 SMART
Blast:IlGF 191 321 1e-71 BLAST
low complexity region 322 333 N/A INTRINSIC
low complexity region 474 493 N/A INTRINSIC
coiled coil region 500 547 N/A INTRINSIC
SAM 566 632 2.42e-2 SMART
RING 679 713 3.51e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000028135
AA Change: M372L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000028135
Gene: ENSMUSG00000026796
AA Change: M372L

DomainStartEndE-ValueType
PH 69 194 1.81e-2 SMART
low complexity region 594 607 N/A INTRINSIC
low complexity region 685 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113200
SMART Domains Protein: ENSMUSP00000108825
Gene: ENSMUSG00000026792

DomainStartEndE-ValueType
LRR 80 102 1.26e1 SMART
LRR 103 125 9.3e-1 SMART
LRR 126 148 1.91e1 SMART
LRR 149 171 7.05e-1 SMART
Blast:IlGF 191 321 1e-71 BLAST
low complexity region 322 333 N/A INTRINSIC
low complexity region 474 493 N/A INTRINSIC
coiled coil region 500 547 N/A INTRINSIC
SAM 566 632 2.42e-2 SMART
RING 679 713 3.51e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 C A 2: 155,556,404 H348Q probably benign Het
Ago1 T A 4: 126,463,723 Y53F probably benign Het
Arrdc5 A G 17: 56,294,342 L261P probably benign Het
Asb2 C A 12: 103,323,879 W551L possibly damaging Het
Atl2 T C 17: 79,852,803 I452V probably benign Het
Atxn7l3 T C 11: 102,292,719 S203G probably benign Het
Bche A G 3: 73,701,173 F307L probably benign Het
C6 T C 15: 4,796,972 V679A probably benign Het
Cd163 A T 6: 124,320,510 N872Y probably damaging Het
Cdkal1 C A 13: 29,474,624 V380F probably damaging Het
Ceacam11 A T 7: 17,975,611 I245L probably benign Het
Ceacam16 G T 7: 19,858,731 T84K possibly damaging Het
Ceacam2 T A 7: 25,527,926 Q172L probably benign Het
Chga T G 12: 102,561,461 S125A possibly damaging Het
Col9a1 T C 1: 24,196,967 probably null Het
Crybg3 C A 16: 59,560,184 A236S probably benign Het
Csmd1 A G 8: 15,910,528 Y3296H probably damaging Het
Cyp2j8 C A 4: 96,470,570 V371L possibly damaging Het
Des C A 1: 75,360,493 L26M unknown Het
Edc3 A G 9: 57,716,201 S140G possibly damaging Het
Fam105a T A 15: 27,664,798 H24L probably benign Het
Fam161a C T 11: 23,020,092 T90I probably benign Het
Fancm T C 12: 65,126,748 Y1945H probably damaging Het
Fbn2 C T 18: 58,124,246 V350I probably benign Het
Git2 A G 5: 114,761,588 C235R possibly damaging Het
Gk2 T C 5: 97,456,482 K166E probably benign Het
Gm12258 G A 11: 58,859,286 R429H unknown Het
Gmppa A G 1: 75,438,288 Y59C probably damaging Het
Has1 G T 17: 17,850,059 A200E possibly damaging Het
Hbs1l T C 10: 21,358,812 I588T possibly damaging Het
Helz2 A G 2: 181,232,767 V1978A possibly damaging Het
Hoxb9 T C 11: 96,274,731 Y209H probably damaging Het
Hps5 T C 7: 46,771,921 D706G probably benign Het
Hydin T C 8: 110,309,088 V137A probably benign Het
Ifngr2 T C 16: 91,562,959 I318T probably benign Het
Iqgap3 C T 3: 88,113,225 T1290I probably damaging Het
Jrk A T 15: 74,707,139 V99E probably benign Het
Kalrn G A 16: 34,198,460 P1311S probably benign Het
Kalrn G A 16: 34,205,326 T931M probably damaging Het
Klk9 T C 7: 43,794,358 F99L possibly damaging Het
Lamb3 T C 1: 193,330,816 C450R probably damaging Het
Lyst T A 13: 13,641,076 S1182T probably benign Het
Map1a T C 2: 121,307,644 V2933A probably damaging Het
Map2k5 A T 9: 63,343,385 probably null Het
Mcm6 A G 1: 128,355,511 probably null Het
Mmp17 G A 5: 129,606,314 V505M probably damaging Het
Mpped2 A G 2: 106,744,720 D50G probably damaging Het
Mtf1 T A 4: 124,821,230 L216* probably null Het
Obscn T C 11: 58,999,812 E7298G unknown Het
Olfr39 A G 9: 20,286,062 D129G probably damaging Het
Olfr598 A T 7: 103,329,005 H173L possibly damaging Het
Olfr679 T C 7: 105,086,556 L280P probably damaging Het
Olfr775 T C 10: 129,251,014 L160P probably benign Het
Pax2 G A 19: 44,788,776 probably null Het
Pcnt T A 10: 76,408,841 E1135V probably damaging Het
Pgap3 A T 11: 98,391,098 V129D probably benign Het
Polq A G 16: 37,040,507 N497S probably benign Het
Ppfia4 T C 1: 134,299,384 T1138A Het
Prickle4 A G 17: 47,690,662 L32P Het
Prl2c2 C T 13: 12,997,311 G158R probably damaging Het
Psd3 A G 8: 67,758,098 I752T probably benign Het
Sag A T 1: 87,828,436 Y255F probably benign Het
Scn7a A T 2: 66,675,855 D1563E probably damaging Het
Secisbp2 A G 13: 51,683,368 N855S probably benign Het
Setd2 T C 9: 110,592,399 V2011A probably benign Het
Slc30a6 T C 17: 74,423,117 V334A probably damaging Het
Spen A G 4: 141,477,209 V1369A unknown Het
Stac2 T C 11: 98,041,547 T207A probably benign Het
Syne2 T C 12: 75,905,293 V445A probably benign Het
Tas2r131 C A 6: 132,957,504 W114L probably damaging Het
Tgfbrap1 G A 1: 43,049,799 R815* probably null Het
Trpv2 A T 11: 62,590,286 I404L probably benign Het
Zfp236 G A 18: 82,598,997 T1791M probably damaging Het
Other mutations in Fam129b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Fam129b APN 2 32912471 missense probably benign 0.04
IGL01072:Fam129b APN 2 32912415 unclassified probably benign
IGL01874:Fam129b APN 2 32905767 critical splice acceptor site probably null
IGL02302:Fam129b APN 2 32921123 missense probably benign
IGL02681:Fam129b APN 2 32911390 missense probably benign 0.05
IGL03126:Fam129b APN 2 32876386 missense possibly damaging 0.95
IGL03240:Fam129b APN 2 32922097 missense probably benign 0.00
R0125:Fam129b UTSW 2 32923821 missense probably benign 0.17
R0948:Fam129b UTSW 2 32922860 missense probably damaging 1.00
R1195:Fam129b UTSW 2 32919803 missense probably benign
R1195:Fam129b UTSW 2 32919803 missense probably benign
R1195:Fam129b UTSW 2 32919803 missense probably benign
R2130:Fam129b UTSW 2 32923647 missense probably benign 0.34
R2408:Fam129b UTSW 2 32923470 missense probably damaging 1.00
R4881:Fam129b UTSW 2 32922578 nonsense probably null
R5506:Fam129b UTSW 2 32920982 missense probably damaging 0.96
R5748:Fam129b UTSW 2 32919569 missense probably damaging 1.00
R5857:Fam129b UTSW 2 32909908 missense probably benign 0.28
R6011:Fam129b UTSW 2 32922865 missense probably damaging 0.99
R6088:Fam129b UTSW 2 32923123 missense probably damaging 1.00
R6720:Fam129b UTSW 2 32905826 missense probably damaging 1.00
R6763:Fam129b UTSW 2 32911448 critical splice donor site probably null
R6769:Fam129b UTSW 2 32895654
R7296:Fam129b UTSW 2 32922642 missense possibly damaging 0.74
R7769:Fam129b UTSW 2 32919832 missense possibly damaging 0.93
R7888:Fam129b UTSW 2 32922125 nonsense probably null
R8282:Fam129b UTSW 2 32919017 missense probably benign 0.02
R8685:Fam129b UTSW 2 32919089 missense probably benign 0.03
R8729:Fam129b UTSW 2 32909934 missense probably damaging 1.00
R8916:Fam129b UTSW 2 32921094 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- ATTGTGTCCCAGGCTCTGTC -3'
(R):5'- CTTGCTCCATAAAGACTGATGGTAC -3'

Sequencing Primer
(F):5'- GGCTCTGTCACCAACGAAATTCTC -3'
(R):5'- TAAAAATACCCACTCTTTCCTCTAGG -3'
Posted On2021-07-15