Incidental Mutation 'R8878:Scn7a'
ID 676673
Institutional Source Beutler Lab
Gene Symbol Scn7a
Ensembl Gene ENSMUSG00000034810
Gene Name sodium channel, voltage-gated, type VII, alpha
Synonyms NaG, Nav2, Nav2.3, Nax, Scn6a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock # R8878 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 66673425-66784914 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 66675855 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1563 (D1563E)
Ref Sequence ENSEMBL: ENSMUSP00000042405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042792]
AlphaFold B1AYL1
Predicted Effect probably damaging
Transcript: ENSMUST00000042792
AA Change: D1563E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000042405
Gene: ENSMUSG00000034810
AA Change: D1563E

DomainStartEndE-ValueType
Pfam:Ion_trans 118 405 4.7e-53 PFAM
coiled coil region 415 443 N/A INTRINSIC
Pfam:Ion_trans 505 739 5.8e-36 PFAM
Pfam:Na_trans_assoc 741 929 4.1e-17 PFAM
Pfam:Ion_trans 933 1204 3e-49 PFAM
Pfam:Ion_trans 1250 1505 5e-37 PFAM
IQ 1624 1646 6.4e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the many voltage-gated sodium channel proteins. For proper functioning of neurons and muscles during action potentials, voltage-gated sodium channels direct sodium ion diffusion for membrane depolarization. This sodium channel protein has some atypical characteristics; the similarity between the human and mouse proteins is lower compared to other orthologous sodium channel pairs. Also, the S4 segments, which sense voltage changes, have fewer positive charged residues that in other sodium channels; domain 4 has fewer arginine and lysine residues compared to other sodium channel proteins. Several alternatively spliced transcript variants exist, but the full-length natures of all of them remain unknown. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have a modified dietary preference for NaCl but are phenotypically normal otherwise. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 C A 2: 155,556,404 H348Q probably benign Het
Ago1 T A 4: 126,463,723 Y53F probably benign Het
Arrdc5 A G 17: 56,294,342 L261P probably benign Het
Asb2 C A 12: 103,323,879 W551L possibly damaging Het
Atl2 T C 17: 79,852,803 I452V probably benign Het
Atxn7l3 T C 11: 102,292,719 S203G probably benign Het
Bche A G 3: 73,701,173 F307L probably benign Het
C6 T C 15: 4,796,972 V679A probably benign Het
Cd163 A T 6: 124,320,510 N872Y probably damaging Het
Cdkal1 C A 13: 29,474,624 V380F probably damaging Het
Ceacam11 A T 7: 17,975,611 I245L probably benign Het
Ceacam16 G T 7: 19,858,731 T84K possibly damaging Het
Ceacam2 T A 7: 25,527,926 Q172L probably benign Het
Chga T G 12: 102,561,461 S125A possibly damaging Het
Col9a1 T C 1: 24,196,967 probably null Het
Crybg3 C A 16: 59,560,184 A236S probably benign Het
Csmd1 A G 8: 15,910,528 Y3296H probably damaging Het
Cyp2j8 C A 4: 96,470,570 V371L possibly damaging Het
Des C A 1: 75,360,493 L26M unknown Het
Edc3 A G 9: 57,716,201 S140G possibly damaging Het
Fam105a T A 15: 27,664,798 H24L probably benign Het
Fam129b A T 2: 32,921,093 M372L probably benign Het
Fam161a C T 11: 23,020,092 T90I probably benign Het
Fancm T C 12: 65,126,748 Y1945H probably damaging Het
Fbn2 C T 18: 58,124,246 V350I probably benign Het
Git2 A G 5: 114,761,588 C235R possibly damaging Het
Gk2 T C 5: 97,456,482 K166E probably benign Het
Gm12258 G A 11: 58,859,286 R429H unknown Het
Gm7247 T G 14: 51,428,753 probably benign Het
Gmppa A G 1: 75,438,288 Y59C probably damaging Het
Has1 G T 17: 17,850,059 A200E possibly damaging Het
Hbs1l T C 10: 21,358,812 I588T possibly damaging Het
Helz2 A G 2: 181,232,767 V1978A possibly damaging Het
Hoxb9 T C 11: 96,274,731 Y209H probably damaging Het
Hps5 T C 7: 46,771,921 D706G probably benign Het
Hydin T C 8: 110,309,088 V137A probably benign Het
Ifngr2 T C 16: 91,562,959 I318T probably benign Het
Iqgap3 C T 3: 88,113,225 T1290I probably damaging Het
Jrk A T 15: 74,707,139 V99E probably benign Het
Kalrn G A 16: 34,198,460 P1311S probably benign Het
Kalrn G A 16: 34,205,326 T931M probably damaging Het
Kirrel3 A G 9: 34,939,265 probably benign Het
Klk9 T C 7: 43,794,358 F99L possibly damaging Het
Lamb3 T C 1: 193,330,816 C450R probably damaging Het
Lyst T A 13: 13,641,076 S1182T probably benign Het
Map1a T C 2: 121,307,644 V2933A probably damaging Het
Map2k5 A T 9: 63,343,385 probably null Het
Mcm6 A G 1: 128,355,511 probably null Het
Mmp17 G A 5: 129,606,314 V505M probably damaging Het
Mpped2 A G 2: 106,744,720 D50G probably damaging Het
Mtf1 T A 4: 124,821,230 L216* probably null Het
Obscn T C 11: 58,999,812 E7298G unknown Het
Olfr39 A G 9: 20,286,062 D129G probably damaging Het
Olfr598 A T 7: 103,329,005 H173L possibly damaging Het
Olfr679 T C 7: 105,086,556 L280P probably damaging Het
Olfr775 T C 10: 129,251,014 L160P probably benign Het
Pax2 G A 19: 44,788,776 probably null Het
Pcnt T A 10: 76,408,841 E1135V probably damaging Het
Pgap3 A T 11: 98,391,098 V129D probably benign Het
Polq A G 16: 37,040,507 N497S probably benign Het
Ppfia4 T C 1: 134,299,384 T1138A Het
Prickle4 A G 17: 47,690,662 L32P Het
Prl2c2 C T 13: 12,997,311 G158R probably damaging Het
Psd3 A G 8: 67,758,098 I752T probably benign Het
Sag A T 1: 87,828,436 Y255F probably benign Het
Secisbp2 A G 13: 51,683,368 N855S probably benign Het
Setd2 T C 9: 110,592,399 V2011A probably benign Het
Slc30a6 T C 17: 74,423,117 V334A probably damaging Het
Spen A G 4: 141,477,209 V1369A unknown Het
Stac2 T C 11: 98,041,547 T207A probably benign Het
Syne2 T C 12: 75,905,293 V445A probably benign Het
Tas2r131 C A 6: 132,957,504 W114L probably damaging Het
Tgfbrap1 G A 1: 43,049,799 R815* probably null Het
Trpv2 A T 11: 62,590,286 I404L probably benign Het
Zfp236 G A 18: 82,598,997 T1791M probably damaging Het
Other mutations in Scn7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Scn7a APN 2 66683327 splice site probably benign
IGL00432:Scn7a APN 2 66741982 nonsense probably null
IGL00720:Scn7a APN 2 66676044 missense possibly damaging 0.67
IGL00783:Scn7a APN 2 66692564 missense probably damaging 0.99
IGL00784:Scn7a APN 2 66692564 missense probably damaging 0.99
IGL00926:Scn7a APN 2 66684131 missense probably benign 0.06
IGL00963:Scn7a APN 2 66703945 splice site probably benign
IGL01099:Scn7a APN 2 66684238 missense probably damaging 1.00
IGL01326:Scn7a APN 2 66752260 missense probably benign 0.13
IGL01538:Scn7a APN 2 66703852 missense probably benign
IGL01624:Scn7a APN 2 66751925 missense probably benign 0.07
IGL01794:Scn7a APN 2 66675509 missense probably benign
IGL02100:Scn7a APN 2 66675499 makesense probably null
IGL02326:Scn7a APN 2 66700048 missense probably benign 0.00
IGL02472:Scn7a APN 2 66752314 missense probably damaging 1.00
IGL02528:Scn7a APN 2 66700175 missense probably damaging 1.00
IGL02798:Scn7a APN 2 66713875 missense probably benign 0.00
IGL03026:Scn7a APN 2 66676098 missense probably damaging 0.99
IGL03071:Scn7a APN 2 66699947 missense possibly damaging 0.89
IGL03080:Scn7a APN 2 66697816 missense probably benign 0.01
IGL03180:Scn7a APN 2 66676234 missense possibly damaging 0.94
IGL03337:Scn7a APN 2 66675960 missense probably benign 0.00
alert UTSW 2 66680246 nonsense probably null
glimmer UTSW 2 66743703 missense probably damaging 0.96
Uptick UTSW 2 66700049 nonsense probably null
PIT4514001:Scn7a UTSW 2 66684179 missense probably damaging 1.00
R0004:Scn7a UTSW 2 66687795 missense possibly damaging 0.81
R0076:Scn7a UTSW 2 66714037 missense probably benign 0.04
R0230:Scn7a UTSW 2 66726284 missense probably damaging 1.00
R0463:Scn7a UTSW 2 66675740 missense probably benign 0.05
R0846:Scn7a UTSW 2 66697600 missense possibly damaging 0.71
R1237:Scn7a UTSW 2 66680295 missense probably damaging 0.98
R1282:Scn7a UTSW 2 66700849 missense probably damaging 0.98
R1467:Scn7a UTSW 2 66689558 missense probably benign 0.01
R1467:Scn7a UTSW 2 66689558 missense probably benign 0.01
R1501:Scn7a UTSW 2 66700163 missense probably benign 0.37
R1672:Scn7a UTSW 2 66697600 missense possibly damaging 0.71
R1690:Scn7a UTSW 2 66675943 missense probably damaging 0.99
R1712:Scn7a UTSW 2 66705103 missense probably benign 0.05
R1758:Scn7a UTSW 2 66680183 missense probably benign 0.00
R1758:Scn7a UTSW 2 66700887 missense probably damaging 0.97
R1775:Scn7a UTSW 2 66680955 missense probably benign 0.02
R1848:Scn7a UTSW 2 66684013 critical splice donor site probably null
R1851:Scn7a UTSW 2 66680291 missense probably benign
R1919:Scn7a UTSW 2 66699973 missense probably damaging 1.00
R1932:Scn7a UTSW 2 66676102 missense probably damaging 1.00
R1945:Scn7a UTSW 2 66675980 missense probably damaging 1.00
R1970:Scn7a UTSW 2 66684289 missense possibly damaging 0.89
R1998:Scn7a UTSW 2 66683269 missense probably damaging 0.99
R2008:Scn7a UTSW 2 66687747 missense possibly damaging 0.82
R2038:Scn7a UTSW 2 66737436 missense probably damaging 1.00
R2113:Scn7a UTSW 2 66675968 missense probably damaging 1.00
R2128:Scn7a UTSW 2 66697986 missense probably damaging 0.99
R2163:Scn7a UTSW 2 66675956 missense probably damaging 0.97
R2421:Scn7a UTSW 2 66726302 splice site probably benign
R2446:Scn7a UTSW 2 66692658 missense probably damaging 0.98
R2922:Scn7a UTSW 2 66700207 splice site probably benign
R3015:Scn7a UTSW 2 66699896 missense probably benign 0.08
R3034:Scn7a UTSW 2 66682808 missense probably damaging 1.00
R3419:Scn7a UTSW 2 66700895 frame shift probably null
R3429:Scn7a UTSW 2 66700895 frame shift probably null
R3430:Scn7a UTSW 2 66700895 frame shift probably null
R3434:Scn7a UTSW 2 66675503 missense probably benign 0.01
R3803:Scn7a UTSW 2 66680246 nonsense probably null
R3831:Scn7a UTSW 2 66697684 missense probably damaging 0.96
R3833:Scn7a UTSW 2 66697684 missense probably damaging 0.96
R4017:Scn7a UTSW 2 66741985 missense probably damaging 1.00
R4244:Scn7a UTSW 2 66742001 missense probably benign 0.00
R4245:Scn7a UTSW 2 66742001 missense probably benign 0.00
R4276:Scn7a UTSW 2 66684063 missense probably damaging 0.97
R4307:Scn7a UTSW 2 66675755 missense possibly damaging 0.47
R4327:Scn7a UTSW 2 66737471 missense probably damaging 1.00
R4353:Scn7a UTSW 2 66676436 missense probably benign 0.00
R4721:Scn7a UTSW 2 66684185 missense probably damaging 1.00
R4722:Scn7a UTSW 2 66700884 missense possibly damaging 0.95
R4781:Scn7a UTSW 2 66703760 missense possibly damaging 0.95
R4792:Scn7a UTSW 2 66726248 missense probably damaging 1.00
R5362:Scn7a UTSW 2 66699998 missense probably damaging 1.00
R5437:Scn7a UTSW 2 66676346 missense probably damaging 1.00
R5729:Scn7a UTSW 2 66741957 critical splice donor site probably null
R5777:Scn7a UTSW 2 66692569 missense probably damaging 1.00
R5785:Scn7a UTSW 2 66697568 missense possibly damaging 0.79
R5821:Scn7a UTSW 2 66743703 missense probably damaging 0.96
R5830:Scn7a UTSW 2 66714051 nonsense probably null
R5877:Scn7a UTSW 2 66699873 nonsense probably null
R5881:Scn7a UTSW 2 66675526 missense probably benign 0.01
R5967:Scn7a UTSW 2 66675713 missense probably damaging 1.00
R5988:Scn7a UTSW 2 66726214 nonsense probably null
R6077:Scn7a UTSW 2 66697596 missense probably damaging 1.00
R6135:Scn7a UTSW 2 66703900 missense probably benign
R6242:Scn7a UTSW 2 66700766 missense probably benign 0.00
R6264:Scn7a UTSW 2 66675526 missense possibly damaging 0.93
R6291:Scn7a UTSW 2 66700114 missense probably damaging 0.98
R6544:Scn7a UTSW 2 66684100 missense probably damaging 1.00
R6770:Scn7a UTSW 2 66729184 splice site probably null
R6997:Scn7a UTSW 2 66703803 missense probably damaging 1.00
R7014:Scn7a UTSW 2 66741959 missense probably null 1.00
R7126:Scn7a UTSW 2 66757286 missense possibly damaging 0.80
R7129:Scn7a UTSW 2 66700193 missense probably benign 0.14
R7176:Scn7a UTSW 2 66676288 missense probably damaging 1.00
R7185:Scn7a UTSW 2 66687795 missense possibly damaging 0.81
R7276:Scn7a UTSW 2 66757162 missense probably damaging 1.00
R7332:Scn7a UTSW 2 66692554 nonsense probably null
R7421:Scn7a UTSW 2 66675532 missense probably benign 0.07
R7488:Scn7a UTSW 2 66757230 missense probably benign 0.16
R7636:Scn7a UTSW 2 66743828 missense possibly damaging 0.67
R7685:Scn7a UTSW 2 66676192 missense probably damaging 1.00
R7711:Scn7a UTSW 2 66700877 missense probably damaging 1.00
R7813:Scn7a UTSW 2 66676345 missense probably damaging 1.00
R7833:Scn7a UTSW 2 66676150 missense probably damaging 1.00
R7914:Scn7a UTSW 2 66699950 missense probably damaging 0.97
R7953:Scn7a UTSW 2 66757326 missense possibly damaging 0.90
R7970:Scn7a UTSW 2 66675829 missense probably damaging 1.00
R8061:Scn7a UTSW 2 66692594 missense probably damaging 1.00
R8121:Scn7a UTSW 2 66700859 missense probably damaging 1.00
R8172:Scn7a UTSW 2 66675847 missense possibly damaging 0.90
R8209:Scn7a UTSW 2 66700860 missense possibly damaging 0.88
R8226:Scn7a UTSW 2 66700860 missense possibly damaging 0.88
R8288:Scn7a UTSW 2 66675974 missense probably damaging 1.00
R8431:Scn7a UTSW 2 66703820 missense possibly damaging 0.62
R8678:Scn7a UTSW 2 66743697 splice site probably benign
R8745:Scn7a UTSW 2 66680182 missense probably benign
R8781:Scn7a UTSW 2 66737431 missense probably benign 0.03
R8848:Scn7a UTSW 2 66700049 nonsense probably null
R8943:Scn7a UTSW 2 66694862 synonymous silent
R8991:Scn7a UTSW 2 66684244 missense possibly damaging 0.65
R9147:Scn7a UTSW 2 66684163 missense possibly damaging 0.89
R9148:Scn7a UTSW 2 66684163 missense possibly damaging 0.89
R9402:Scn7a UTSW 2 66680112 missense probably damaging 1.00
R9501:Scn7a UTSW 2 66752235 missense probably benign 0.00
R9546:Scn7a UTSW 2 66752259 missense possibly damaging 0.93
R9715:Scn7a UTSW 2 66689558 missense possibly damaging 0.93
X0060:Scn7a UTSW 2 66689682 missense probably benign 0.01
X0066:Scn7a UTSW 2 66680192 missense probably benign
Z1088:Scn7a UTSW 2 66713951 missense probably damaging 0.98
Z1177:Scn7a UTSW 2 66752269 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGGTCATCTATAGCAGGAG -3'
(R):5'- CAGGACCTTGAGTGAAGATGAC -3'

Sequencing Primer
(F):5'- ATGGTTGCTGAAACTGCCTC -3'
(R):5'- AAGATGACTTTAGGAGATTCTTCCGG -3'
Posted On 2021-07-15