Incidental Mutation 'R8878:Cyp2j8'
ID676680
Institutional Source Beutler Lab
Gene Symbol Cyp2j8
Ensembl Gene ENSMUSG00000082932
Gene Namecytochrome P450, family 2, subfamily j, polypeptide 8
SynonymsCyp2j8-ps, OTTMUSG00000007938
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R8878 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location96444596-96507386 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 96470570 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 371 (V371L)
Ref Sequence ENSEMBL: ENSMUSP00000134591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124729]
Predicted Effect possibly damaging
Transcript: ENSMUST00000124729
AA Change: V371L

PolyPhen 2 Score 0.559 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134591
Gene: ENSMUSG00000082932
AA Change: V371L

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 44 500 1.2e-134 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 C A 2: 155,556,404 H348Q probably benign Het
Ago1 T A 4: 126,463,723 Y53F probably benign Het
Arrdc5 A G 17: 56,294,342 L261P probably benign Het
Asb2 C A 12: 103,323,879 W551L possibly damaging Het
Atl2 T C 17: 79,852,803 I452V probably benign Het
Atxn7l3 T C 11: 102,292,719 S203G probably benign Het
Bche A G 3: 73,701,173 F307L probably benign Het
C6 T C 15: 4,796,972 V679A probably benign Het
Cd163 A T 6: 124,320,510 N872Y probably damaging Het
Cdkal1 C A 13: 29,474,624 V380F probably damaging Het
Ceacam11 A T 7: 17,975,611 I245L probably benign Het
Ceacam16 G T 7: 19,858,731 T84K possibly damaging Het
Ceacam2 T A 7: 25,527,926 Q172L probably benign Het
Chga T G 12: 102,561,461 S125A possibly damaging Het
Col9a1 T C 1: 24,196,967 probably null Het
Crybg3 C A 16: 59,560,184 A236S probably benign Het
Csmd1 A G 8: 15,910,528 Y3296H probably damaging Het
Des C A 1: 75,360,493 L26M unknown Het
Edc3 A G 9: 57,716,201 S140G possibly damaging Het
Fam105a T A 15: 27,664,798 H24L probably benign Het
Fam129b A T 2: 32,921,093 M372L probably benign Het
Fam161a C T 11: 23,020,092 T90I probably benign Het
Fancm T C 12: 65,126,748 Y1945H probably damaging Het
Fbn2 C T 18: 58,124,246 V350I probably benign Het
Git2 A G 5: 114,761,588 C235R possibly damaging Het
Gk2 T C 5: 97,456,482 K166E probably benign Het
Gm12258 G A 11: 58,859,286 R429H unknown Het
Gmppa A G 1: 75,438,288 Y59C probably damaging Het
Has1 G T 17: 17,850,059 A200E possibly damaging Het
Hbs1l T C 10: 21,358,812 I588T possibly damaging Het
Helz2 A G 2: 181,232,767 V1978A possibly damaging Het
Hoxb9 T C 11: 96,274,731 Y209H probably damaging Het
Hps5 T C 7: 46,771,921 D706G probably benign Het
Hydin T C 8: 110,309,088 V137A probably benign Het
Ifngr2 T C 16: 91,562,959 I318T probably benign Het
Iqgap3 C T 3: 88,113,225 T1290I probably damaging Het
Jrk A T 15: 74,707,139 V99E probably benign Het
Kalrn G A 16: 34,198,460 P1311S probably benign Het
Kalrn G A 16: 34,205,326 T931M probably damaging Het
Klk9 T C 7: 43,794,358 F99L possibly damaging Het
Lamb3 T C 1: 193,330,816 C450R probably damaging Het
Lyst T A 13: 13,641,076 S1182T probably benign Het
Map1a T C 2: 121,307,644 V2933A probably damaging Het
Map2k5 A T 9: 63,343,385 probably null Het
Mcm6 A G 1: 128,355,511 probably null Het
Mmp17 G A 5: 129,606,314 V505M probably damaging Het
Mpped2 A G 2: 106,744,720 D50G probably damaging Het
Mtf1 T A 4: 124,821,230 L216* probably null Het
Obscn T C 11: 58,999,812 E7298G unknown Het
Olfr39 A G 9: 20,286,062 D129G probably damaging Het
Olfr598 A T 7: 103,329,005 H173L possibly damaging Het
Olfr679 T C 7: 105,086,556 L280P probably damaging Het
Olfr775 T C 10: 129,251,014 L160P probably benign Het
Pax2 G A 19: 44,788,776 probably null Het
Pcnt T A 10: 76,408,841 E1135V probably damaging Het
Pgap3 A T 11: 98,391,098 V129D probably benign Het
Polq A G 16: 37,040,507 N497S probably benign Het
Ppfia4 T C 1: 134,299,384 T1138A Het
Prickle4 A G 17: 47,690,662 L32P Het
Prl2c2 C T 13: 12,997,311 G158R probably damaging Het
Psd3 A G 8: 67,758,098 I752T probably benign Het
Sag A T 1: 87,828,436 Y255F probably benign Het
Scn7a A T 2: 66,675,855 D1563E probably damaging Het
Secisbp2 A G 13: 51,683,368 N855S probably benign Het
Setd2 T C 9: 110,592,399 V2011A probably benign Het
Slc30a6 T C 17: 74,423,117 V334A probably damaging Het
Spen A G 4: 141,477,209 V1369A unknown Het
Stac2 T C 11: 98,041,547 T207A probably benign Het
Syne2 T C 12: 75,905,293 V445A probably benign Het
Tas2r131 C A 6: 132,957,504 W114L probably damaging Het
Tgfbrap1 G A 1: 43,049,799 R815* probably null Het
Trpv2 A T 11: 62,590,286 I404L probably benign Het
Zfp236 G A 18: 82,598,997 T1791M probably damaging Het
Other mutations in Cyp2j8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Cyp2j8 APN 4 96503842 missense probably benign 0.06
IGL00418:Cyp2j8 APN 4 96444616 missense possibly damaging 0.85
IGL01577:Cyp2j8 APN 4 96479071 missense probably damaging 0.96
IGL01629:Cyp2j8 APN 4 96499603 missense probably damaging 1.00
IGL01928:Cyp2j8 APN 4 96470476 splice site probably benign
IGL01978:Cyp2j8 APN 4 96504009 splice site probably null
IGL02053:Cyp2j8 APN 4 96470654 missense probably damaging 1.00
IGL02500:Cyp2j8 APN 4 96470650 missense probably damaging 1.00
IGL02947:Cyp2j8 APN 4 96470578 missense probably damaging 1.00
cyprus UTSW 4 96499603 missense probably damaging 1.00
R0558:Cyp2j8 UTSW 4 96444634 missense probably benign 0.01
R0718:Cyp2j8 UTSW 4 96501196 missense probably benign
R1553:Cyp2j8 UTSW 4 96475557 missense probably benign
R1557:Cyp2j8 UTSW 4 96470476 splice site probably benign
R1632:Cyp2j8 UTSW 4 96447324 missense probably benign 0.02
R1708:Cyp2j8 UTSW 4 96499595 missense probably damaging 1.00
R2119:Cyp2j8 UTSW 4 96507201 missense probably benign
R2220:Cyp2j8 UTSW 4 96444625 missense probably benign 0.03
R3123:Cyp2j8 UTSW 4 96501213 splice site probably benign
R3735:Cyp2j8 UTSW 4 96444599 missense probably damaging 1.00
R3736:Cyp2j8 UTSW 4 96444599 missense probably damaging 1.00
R4326:Cyp2j8 UTSW 4 96507329 missense probably benign 0.10
R4327:Cyp2j8 UTSW 4 96507329 missense probably benign 0.10
R4762:Cyp2j8 UTSW 4 96470649 missense probably damaging 1.00
R4901:Cyp2j8 UTSW 4 96479086 missense probably benign 0.16
R4960:Cyp2j8 UTSW 4 96507377 missense probably benign
R5260:Cyp2j8 UTSW 4 96501064 missense possibly damaging 0.65
R5562:Cyp2j8 UTSW 4 96470653 missense probably damaging 1.00
R5596:Cyp2j8 UTSW 4 96507341 missense probably benign 0.00
R5741:Cyp2j8 UTSW 4 96444643 missense probably benign 0.00
R5825:Cyp2j8 UTSW 4 96507214 missense probably benign 0.01
R5903:Cyp2j8 UTSW 4 96507277 missense possibly damaging 0.46
R6122:Cyp2j8 UTSW 4 96444640 missense probably benign
R6232:Cyp2j8 UTSW 4 96507190 missense possibly damaging 0.94
R6748:Cyp2j8 UTSW 4 96475545 missense probably benign 0.01
R6931:Cyp2j8 UTSW 4 96444781 splice site probably null
R7000:Cyp2j8 UTSW 4 96447351 missense probably benign 0.06
R7183:Cyp2j8 UTSW 4 96479181 missense probably damaging 0.97
R7186:Cyp2j8 UTSW 4 96475550 missense probably benign 0.00
R7348:Cyp2j8 UTSW 4 96444640 missense probably benign 0.00
R7575:Cyp2j8 UTSW 4 96470548 missense possibly damaging 0.63
R7648:Cyp2j8 UTSW 4 96499603 missense probably damaging 1.00
R7975:Cyp2j8 UTSW 4 96470539 missense possibly damaging 0.65
R7993:Cyp2j8 UTSW 4 96447219 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTTTTAGGCTCATTGGAGGAATAC -3'
(R):5'- TCCTTCTTTGGATGTTAGGATACAG -3'

Sequencing Primer
(F):5'- TTATTTCTTGAGGCAGAAATAGACG -3'
(R):5'- TGTTAGGATACAGAATAGCTTGACC -3'
Posted On2021-07-15