Incidental Mutation 'R8878:Ago1'
ID 676682
Institutional Source Beutler Lab
Gene Symbol Ago1
Ensembl Gene ENSMUSG00000041530
Gene Name argonaute RISC catalytic subunit 1
Synonyms Eif2c1, argonaute 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.741) question?
Stock # R8878 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 126435012-126468583 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 126463723 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 53 (Y53F)
Ref Sequence ENSEMBL: ENSMUSP00000095498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097888] [ENSMUST00000176315]
AlphaFold Q8CJG1
Predicted Effect probably benign
Transcript: ENSMUST00000097888
AA Change: Y53F

PolyPhen 2 Score 0.346 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000095498
Gene: ENSMUSG00000041530
AA Change: Y53F

DomainStartEndE-ValueType
Pfam:ArgoN 26 164 2.3e-26 PFAM
DUF1785 173 225 3.48e-25 SMART
PAZ 233 368 1.41e-5 SMART
Pfam:ArgoL2 373 418 3.6e-18 PFAM
Pfam:ArgoMid 427 509 7.6e-37 PFAM
Piwi 515 816 4.16e-131 SMART
Blast:Piwi 823 849 3e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127800
Predicted Effect probably benign
Transcript: ENSMUST00000176315
SMART Domains Protein: ENSMUSP00000134871
Gene: ENSMUSG00000041530

DomainStartEndE-ValueType
Pfam:PAZ 1 62 4.1e-23 PFAM
Piwi 211 512 4.16e-131 SMART
Blast:Piwi 519 545 2e-6 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: This gene encodes a member of the argonaute family of proteins, which associate with small RNAs and have important roles in RNA interference (RNAi) and RNA silencing. This protein binds to microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses translation of mRNAs that are complementary to them. It is also involved in transcriptional gene silencing (TGS) of promoter regions that are complementary to bound short antigene RNAs (agRNAs), as well as in the degradation of miRNA-bound mRNA targets. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA could give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in keratinocytes exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 C A 2: 155,556,404 H348Q probably benign Het
Arrdc5 A G 17: 56,294,342 L261P probably benign Het
Asb2 C A 12: 103,323,879 W551L possibly damaging Het
Atl2 T C 17: 79,852,803 I452V probably benign Het
Atxn7l3 T C 11: 102,292,719 S203G probably benign Het
Bche A G 3: 73,701,173 F307L probably benign Het
C6 T C 15: 4,796,972 V679A probably benign Het
Cd163 A T 6: 124,320,510 N872Y probably damaging Het
Cdkal1 C A 13: 29,474,624 V380F probably damaging Het
Ceacam11 A T 7: 17,975,611 I245L probably benign Het
Ceacam16 G T 7: 19,858,731 T84K possibly damaging Het
Ceacam2 T A 7: 25,527,926 Q172L probably benign Het
Chga T G 12: 102,561,461 S125A possibly damaging Het
Col9a1 T C 1: 24,196,967 probably null Het
Crybg3 C A 16: 59,560,184 A236S probably benign Het
Csmd1 A G 8: 15,910,528 Y3296H probably damaging Het
Cyp2j8 C A 4: 96,470,570 V371L possibly damaging Het
Des C A 1: 75,360,493 L26M unknown Het
Edc3 A G 9: 57,716,201 S140G possibly damaging Het
Fam105a T A 15: 27,664,798 H24L probably benign Het
Fam129b A T 2: 32,921,093 M372L probably benign Het
Fam161a C T 11: 23,020,092 T90I probably benign Het
Fancm T C 12: 65,126,748 Y1945H probably damaging Het
Fbn2 C T 18: 58,124,246 V350I probably benign Het
Git2 A G 5: 114,761,588 C235R possibly damaging Het
Gk2 T C 5: 97,456,482 K166E probably benign Het
Gm12258 G A 11: 58,859,286 R429H unknown Het
Gm7247 T G 14: 51,428,753 probably benign Het
Gmppa A G 1: 75,438,288 Y59C probably damaging Het
Has1 G T 17: 17,850,059 A200E possibly damaging Het
Hbs1l T C 10: 21,358,812 I588T possibly damaging Het
Helz2 A G 2: 181,232,767 V1978A possibly damaging Het
Hoxb9 T C 11: 96,274,731 Y209H probably damaging Het
Hps5 T C 7: 46,771,921 D706G probably benign Het
Hydin T C 8: 110,309,088 V137A probably benign Het
Ifngr2 T C 16: 91,562,959 I318T probably benign Het
Iqgap3 C T 3: 88,113,225 T1290I probably damaging Het
Jrk A T 15: 74,707,139 V99E probably benign Het
Kalrn G A 16: 34,198,460 P1311S probably benign Het
Kalrn G A 16: 34,205,326 T931M probably damaging Het
Kirrel3 A G 9: 34,939,265 probably benign Het
Klk9 T C 7: 43,794,358 F99L possibly damaging Het
Lamb3 T C 1: 193,330,816 C450R probably damaging Het
Lyst T A 13: 13,641,076 S1182T probably benign Het
Map1a T C 2: 121,307,644 V2933A probably damaging Het
Map2k5 A T 9: 63,343,385 probably null Het
Mcm6 A G 1: 128,355,511 probably null Het
Mmp17 G A 5: 129,606,314 V505M probably damaging Het
Mpped2 A G 2: 106,744,720 D50G probably damaging Het
Mtf1 T A 4: 124,821,230 L216* probably null Het
Obscn T C 11: 58,999,812 E7298G unknown Het
Olfr39 A G 9: 20,286,062 D129G probably damaging Het
Olfr598 A T 7: 103,329,005 H173L possibly damaging Het
Olfr679 T C 7: 105,086,556 L280P probably damaging Het
Olfr775 T C 10: 129,251,014 L160P probably benign Het
Pax2 G A 19: 44,788,776 probably null Het
Pcnt T A 10: 76,408,841 E1135V probably damaging Het
Pgap3 A T 11: 98,391,098 V129D probably benign Het
Polq A G 16: 37,040,507 N497S probably benign Het
Ppfia4 T C 1: 134,299,384 T1138A Het
Prickle4 A G 17: 47,690,662 L32P Het
Prl2c2 C T 13: 12,997,311 G158R probably damaging Het
Psd3 A G 8: 67,758,098 I752T probably benign Het
Sag A T 1: 87,828,436 Y255F probably benign Het
Scn7a A T 2: 66,675,855 D1563E probably damaging Het
Secisbp2 A G 13: 51,683,368 N855S probably benign Het
Setd2 T C 9: 110,592,399 V2011A probably benign Het
Slc30a6 T C 17: 74,423,117 V334A probably damaging Het
Spen A G 4: 141,477,209 V1369A unknown Het
Stac2 T C 11: 98,041,547 T207A probably benign Het
Syne2 T C 12: 75,905,293 V445A probably benign Het
Tas2r131 C A 6: 132,957,504 W114L probably damaging Het
Tgfbrap1 G A 1: 43,049,799 R815* probably null Het
Trpv2 A T 11: 62,590,286 I404L probably benign Het
Zfp236 G A 18: 82,598,997 T1791M probably damaging Het
Other mutations in Ago1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Ago1 APN 4 126459817 missense probably damaging 0.98
IGL02578:Ago1 APN 4 126439531 missense probably benign 0.12
IGL02709:Ago1 APN 4 126453640 nonsense probably null
IGL02810:Ago1 APN 4 126443093 missense probably benign 0.00
IGL03037:Ago1 APN 4 126461794 missense probably benign 0.00
IGL03091:Ago1 APN 4 126459189 missense probably damaging 0.98
IGL03100:Ago1 APN 4 126443171 missense probably benign 0.08
IGL03121:Ago1 APN 4 126460003 missense probably benign 0.00
R0195:Ago1 UTSW 4 126463691 missense probably benign 0.01
R0244:Ago1 UTSW 4 126463706 missense possibly damaging 0.94
R0309:Ago1 UTSW 4 126443166 missense probably benign 0.06
R0514:Ago1 UTSW 4 126439595 missense probably benign
R0557:Ago1 UTSW 4 126460024 missense probably benign 0.00
R1104:Ago1 UTSW 4 126453633 missense probably damaging 0.99
R1553:Ago1 UTSW 4 126440401 missense probably damaging 0.99
R1624:Ago1 UTSW 4 126463741 missense probably damaging 0.97
R1851:Ago1 UTSW 4 126439995 missense probably benign 0.00
R1867:Ago1 UTSW 4 126441236 missense probably damaging 0.98
R2001:Ago1 UTSW 4 126454394 missense probably null 0.36
R2051:Ago1 UTSW 4 126460453 missense probably benign 0.01
R2057:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R2105:Ago1 UTSW 4 126461788 missense probably benign 0.30
R2117:Ago1 UTSW 4 126463857 splice site probably null
R2256:Ago1 UTSW 4 126441911 missense possibly damaging 0.80
R2272:Ago1 UTSW 4 126453650 missense probably benign 0.01
R2517:Ago1 UTSW 4 126439939 nonsense probably null
R2850:Ago1 UTSW 4 126443075 splice site probably benign
R2993:Ago1 UTSW 4 126440046 splice site probably benign
R3746:Ago1 UTSW 4 126461044 missense probably benign
R3747:Ago1 UTSW 4 126461044 missense probably benign
R3750:Ago1 UTSW 4 126461044 missense probably benign
R4600:Ago1 UTSW 4 126460392 missense probably benign 0.37
R4934:Ago1 UTSW 4 126448859 missense possibly damaging 0.56
R4983:Ago1 UTSW 4 126453654 missense probably damaging 0.99
R5086:Ago1 UTSW 4 126453604 missense probably benign 0.01
R5132:Ago1 UTSW 4 126461723 missense probably benign 0.01
R5239:Ago1 UTSW 4 126441215 missense probably damaging 1.00
R5609:Ago1 UTSW 4 126461037 missense possibly damaging 0.80
R5705:Ago1 UTSW 4 126448794 missense probably benign 0.01
R5980:Ago1 UTSW 4 126460569 unclassified probably benign
R6036:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R6036:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R6398:Ago1 UTSW 4 126448808 missense probably benign 0.26
R6505:Ago1 UTSW 4 126463835 missense probably benign 0.00
R6545:Ago1 UTSW 4 126454352 missense possibly damaging 0.74
R6944:Ago1 UTSW 4 126460422 missense possibly damaging 0.78
R7041:Ago1 UTSW 4 126463706 missense possibly damaging 0.94
R7490:Ago1 UTSW 4 126439505 makesense probably null
R7496:Ago1 UTSW 4 126461752 missense probably benign 0.20
R7575:Ago1 UTSW 4 126453908 missense probably benign 0.12
R7625:Ago1 UTSW 4 126443229 missense probably benign 0.18
R7988:Ago1 UTSW 4 126460417 missense probably damaging 1.00
R8041:Ago1 UTSW 4 126441936 missense probably damaging 1.00
R8073:Ago1 UTSW 4 126443226 missense probably benign 0.04
R8086:Ago1 UTSW 4 126460981 missense probably benign
R8127:Ago1 UTSW 4 126454421 missense possibly damaging 0.95
R8772:Ago1 UTSW 4 126460523 unclassified probably benign
R8989:Ago1 UTSW 4 126463790 missense probably benign 0.01
R9140:Ago1 UTSW 4 126443184 missense probably benign
X0025:Ago1 UTSW 4 126443115 missense possibly damaging 0.47
Z1177:Ago1 UTSW 4 126453656 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCTCTAGTCTCTGTGCTCATG -3'
(R):5'- ACCAGTGGTCTTGGTCTGAG -3'

Sequencing Primer
(F):5'- GCACATCAGCAAATATTAGACTATGC -3'
(R):5'- CATGTCTGACCACGGTAGGAGAC -3'
Posted On 2021-07-15