Incidental Mutation 'R8878:Hbs1l'
ID676703
Institutional Source Beutler Lab
Gene Symbol Hbs1l
Ensembl Gene ENSMUSG00000019977
Gene NameHbs1-like (S. cerevisiae)
Synonyms2810035F15Rik, eRFS
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8878 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location21295979-21368898 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21358812 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 588 (I588T)
Ref Sequence ENSEMBL: ENSMUSP00000151689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020153] [ENSMUST00000219915]
Predicted Effect probably benign
Transcript: ENSMUST00000020153
AA Change: I585T

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000020153
Gene: ENSMUSG00000019977
AA Change: I585T

DomainStartEndE-ValueType
Pfam:HBS1_N 33 125 1e-22 PFAM
low complexity region 142 155 N/A INTRINSIC
Pfam:GTP_EFTU 256 521 1.7e-48 PFAM
Pfam:GTP_EFTU_D3 572 681 9.2e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000219915
AA Change: I588T

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GTP-binding elongation factor family. It is expressed in multiple tissues with the highest expression in heart and skeletal muscle. The intergenic region of this gene and the MYB gene has been identified to be a quantitative trait locus (QTL) controlling fetal hemoglobin level, and this region influnces erythrocyte, platelet, and monocyte counts as well as erythrocyte volume and hemoglobin content. DNA polymorphisms at this region associate with fetal hemoglobin levels and pain crises in sickle cell disease. A single nucleotide polymorphism in exon 1 of this gene is significantly associated with severity in beta-thalassemia/Hemoglobin E. Multiple alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 C A 2: 155,556,404 H348Q probably benign Het
Ago1 T A 4: 126,463,723 Y53F probably benign Het
Arrdc5 A G 17: 56,294,342 L261P probably benign Het
Asb2 C A 12: 103,323,879 W551L possibly damaging Het
Atl2 T C 17: 79,852,803 I452V probably benign Het
Atxn7l3 T C 11: 102,292,719 S203G probably benign Het
Bche A G 3: 73,701,173 F307L probably benign Het
C6 T C 15: 4,796,972 V679A probably benign Het
Cd163 A T 6: 124,320,510 N872Y probably damaging Het
Cdkal1 C A 13: 29,474,624 V380F probably damaging Het
Ceacam11 A T 7: 17,975,611 I245L probably benign Het
Ceacam16 G T 7: 19,858,731 T84K possibly damaging Het
Ceacam2 T A 7: 25,527,926 Q172L probably benign Het
Chga T G 12: 102,561,461 S125A possibly damaging Het
Col9a1 T C 1: 24,196,967 probably null Het
Crybg3 C A 16: 59,560,184 A236S probably benign Het
Csmd1 A G 8: 15,910,528 Y3296H probably damaging Het
Cyp2j8 C A 4: 96,470,570 V371L possibly damaging Het
Des C A 1: 75,360,493 L26M unknown Het
Edc3 A G 9: 57,716,201 S140G possibly damaging Het
Fam105a T A 15: 27,664,798 H24L probably benign Het
Fam129b A T 2: 32,921,093 M372L probably benign Het
Fam161a C T 11: 23,020,092 T90I probably benign Het
Fancm T C 12: 65,126,748 Y1945H probably damaging Het
Fbn2 C T 18: 58,124,246 V350I probably benign Het
Git2 A G 5: 114,761,588 C235R possibly damaging Het
Gk2 T C 5: 97,456,482 K166E probably benign Het
Gm12258 G A 11: 58,859,286 R429H unknown Het
Gmppa A G 1: 75,438,288 Y59C probably damaging Het
Has1 G T 17: 17,850,059 A200E possibly damaging Het
Helz2 A G 2: 181,232,767 V1978A possibly damaging Het
Hoxb9 T C 11: 96,274,731 Y209H probably damaging Het
Hps5 T C 7: 46,771,921 D706G probably benign Het
Hydin T C 8: 110,309,088 V137A probably benign Het
Ifngr2 T C 16: 91,562,959 I318T probably benign Het
Iqgap3 C T 3: 88,113,225 T1290I probably damaging Het
Jrk A T 15: 74,707,139 V99E probably benign Het
Kalrn G A 16: 34,198,460 P1311S probably benign Het
Kalrn G A 16: 34,205,326 T931M probably damaging Het
Klk9 T C 7: 43,794,358 F99L possibly damaging Het
Lamb3 T C 1: 193,330,816 C450R probably damaging Het
Lyst T A 13: 13,641,076 S1182T probably benign Het
Map1a T C 2: 121,307,644 V2933A probably damaging Het
Map2k5 A T 9: 63,343,385 probably null Het
Mcm6 A G 1: 128,355,511 probably null Het
Mmp17 G A 5: 129,606,314 V505M probably damaging Het
Mpped2 A G 2: 106,744,720 D50G probably damaging Het
Mtf1 T A 4: 124,821,230 L216* probably null Het
Obscn T C 11: 58,999,812 E7298G unknown Het
Olfr39 A G 9: 20,286,062 D129G probably damaging Het
Olfr598 A T 7: 103,329,005 H173L possibly damaging Het
Olfr679 T C 7: 105,086,556 L280P probably damaging Het
Olfr775 T C 10: 129,251,014 L160P probably benign Het
Pax2 G A 19: 44,788,776 probably null Het
Pcnt T A 10: 76,408,841 E1135V probably damaging Het
Pgap3 A T 11: 98,391,098 V129D probably benign Het
Polq A G 16: 37,040,507 N497S probably benign Het
Ppfia4 T C 1: 134,299,384 T1138A Het
Prickle4 A G 17: 47,690,662 L32P Het
Prl2c2 C T 13: 12,997,311 G158R probably damaging Het
Psd3 A G 8: 67,758,098 I752T probably benign Het
Sag A T 1: 87,828,436 Y255F probably benign Het
Scn7a A T 2: 66,675,855 D1563E probably damaging Het
Secisbp2 A G 13: 51,683,368 N855S probably benign Het
Setd2 T C 9: 110,592,399 V2011A probably benign Het
Slc30a6 T C 17: 74,423,117 V334A probably damaging Het
Spen A G 4: 141,477,209 V1369A unknown Het
Stac2 T C 11: 98,041,547 T207A probably benign Het
Syne2 T C 12: 75,905,293 V445A probably benign Het
Tas2r131 C A 6: 132,957,504 W114L probably damaging Het
Tgfbrap1 G A 1: 43,049,799 R815* probably null Het
Trpv2 A T 11: 62,590,286 I404L probably benign Het
Zfp236 G A 18: 82,598,997 T1791M probably damaging Het
Other mutations in Hbs1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01542:Hbs1l APN 10 21307756 missense probably benign 0.03
IGL02948:Hbs1l APN 10 21341711 splice site probably benign
R0375:Hbs1l UTSW 10 21342541 missense possibly damaging 0.76
R0465:Hbs1l UTSW 10 21352041 missense probably null 0.85
R0555:Hbs1l UTSW 10 21349323 missense probably benign 0.14
R0909:Hbs1l UTSW 10 21307738 missense probably benign 0.00
R1172:Hbs1l UTSW 10 21304638 missense probably damaging 1.00
R1594:Hbs1l UTSW 10 21352023 missense probably benign 0.00
R1612:Hbs1l UTSW 10 21358835 missense probably damaging 1.00
R1869:Hbs1l UTSW 10 21358406 splice site probably null
R2109:Hbs1l UTSW 10 21341932 nonsense probably null
R2369:Hbs1l UTSW 10 21307745 missense probably benign 0.01
R2404:Hbs1l UTSW 10 21296047 start gained probably benign
R4077:Hbs1l UTSW 10 21352602 missense probably damaging 1.00
R4079:Hbs1l UTSW 10 21352602 missense probably damaging 1.00
R4534:Hbs1l UTSW 10 21341915 missense possibly damaging 0.74
R4796:Hbs1l UTSW 10 21342506 missense probably damaging 1.00
R4852:Hbs1l UTSW 10 21358388 missense possibly damaging 0.92
R5069:Hbs1l UTSW 10 21354647 missense probably damaging 1.00
R5946:Hbs1l UTSW 10 21341756 missense probably benign
R6232:Hbs1l UTSW 10 21307758 splice site probably null
R6264:Hbs1l UTSW 10 21367757 missense possibly damaging 0.92
R6542:Hbs1l UTSW 10 21304617 missense probably benign 0.11
R6831:Hbs1l UTSW 10 21341868 missense probably benign 0.29
R7295:Hbs1l UTSW 10 21310152 missense probably benign 0.12
R7470:Hbs1l UTSW 10 21358784 missense possibly damaging 0.96
R7652:Hbs1l UTSW 10 21364760 missense probably benign 0.02
R7695:Hbs1l UTSW 10 21299217 missense possibly damaging 0.49
R7909:Hbs1l UTSW 10 21358404 critical splice donor site probably null
R8325:Hbs1l UTSW 10 21307649 missense probably benign 0.02
R8353:Hbs1l UTSW 10 21309279 missense probably benign
R8453:Hbs1l UTSW 10 21309279 missense probably benign
R8880:Hbs1l UTSW 10 21309969 missense probably damaging 0.99
R8933:Hbs1l UTSW 10 21367685 nonsense probably null
X0018:Hbs1l UTSW 10 21351987 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGGGGCAGAGGGTTCTTA -3'
(R):5'- TACATGAGGACAAGCACCCA -3'

Sequencing Primer
(F):5'- CAGGTAGACTTTCCACATTG -3'
(R):5'- TGAGGACAAGCACCCACACAC -3'
Posted On2021-07-15