Mutagenetix > Incidental Mutation

Incidental Mutation 'R8878:Pax2'

676737

Institutional Source

Beutler Lab

Gene Symbol

Pax2

Ensembl Gene

ENSMUSG00000004231

Gene Name

paired box 2

Synonyms

Pax-2, Opdc

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8878 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

44756045-44837871 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

G to A at 44788776 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000134661 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004340] [ENSMUST00000173346] [ENSMUST00000174490]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000004340

SMART Domains

Protein: ENSMUSP00000004340
Gene: ENSMUSG00000004231

Domain	Start	End	E-Value	Type
PAX	15	139	4e-96	SMART
low complexity region	165	177	N/A	INTRINSIC
SCOP:d1ftt__	246	280	1e-4	SMART
Pfam:Pax2_C	300	415	1.1e-55	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173346

SMART Domains

Protein: ENSMUSP00000134311
Gene: ENSMUSG00000004231

Domain	Start	End	E-Value	Type
PAX	20	144	2.3e-96	SMART
low complexity region	170	182	N/A	INTRINSIC
SCOP:d1ftt__	220	254	5e-5	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000174490

SMART Domains

Protein: ENSMUSP00000134661
Gene: ENSMUSG00000004231

Domain	Start	End	E-Value	Type
PAX	16	140	2.3e-96	SMART
low complexity region	166	178	N/A	INTRINSIC
SCOP:d1ftt__	224	258	8e-5	SMART
Pfam:Pax2_C	278	393	6.3e-57	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

99% (73/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PAX2 encodes paired box gene 2, one of many human homologues of the Drosophila melanogaster gene prd. The central feature of this transcription factor gene family is the conserved DNA-binding paired box domain. PAX2 is believed to be a target of transcriptional supression by the tumor suppressor gene WT1. Mutations within PAX2 have been shown to result in optic nerve colobomas and renal hypoplasia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous targeted and spontaneous null mutants show impaired to absent development of optic nerve, retina, kidney, ureters, genital tracts, inner ear and midhindbrain. Heterozygotes show milder defects of the optic nerve, retina and kidney. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acss2	C	A	2: 155,556,404	H348Q	probably benign	Het
Ago1	T	A	4: 126,463,723	Y53F	probably benign	Het
Arrdc5	A	G	17: 56,294,342	L261P	probably benign	Het
Asb2	C	A	12: 103,323,879	W551L	possibly damaging	Het
Atl2	T	C	17: 79,852,803	I452V	probably benign	Het
Atxn7l3	T	C	11: 102,292,719	S203G	probably benign	Het
Bche	A	G	3: 73,701,173	F307L	probably benign	Het
C6	T	C	15: 4,796,972	V679A	probably benign	Het
Cd163	A	T	6: 124,320,510	N872Y	probably damaging	Het
Cdkal1	C	A	13: 29,474,624	V380F	probably damaging	Het
Ceacam11	A	T	7: 17,975,611	I245L	probably benign	Het
Ceacam16	G	T	7: 19,858,731	T84K	possibly damaging	Het
Ceacam2	T	A	7: 25,527,926	Q172L	probably benign	Het
Chga	T	G	12: 102,561,461	S125A	possibly damaging	Het
Col9a1	T	C	1: 24,196,967		probably null	Het
Crybg3	C	A	16: 59,560,184	A236S	probably benign	Het
Csmd1	A	G	8: 15,910,528	Y3296H	probably damaging	Het
Cyp2j8	C	A	4: 96,470,570	V371L	possibly damaging	Het
Des	C	A	1: 75,360,493	L26M	unknown	Het
Edc3	A	G	9: 57,716,201	S140G	possibly damaging	Het
Fam105a	T	A	15: 27,664,798	H24L	probably benign	Het
Fam129b	A	T	2: 32,921,093	M372L	probably benign	Het
Fam161a	C	T	11: 23,020,092	T90I	probably benign	Het
Fancm	T	C	12: 65,126,748	Y1945H	probably damaging	Het
Fbn2	C	T	18: 58,124,246	V350I	probably benign	Het
Git2	A	G	5: 114,761,588	C235R	possibly damaging	Het
Gk2	T	C	5: 97,456,482	K166E	probably benign	Het
Gm12258	G	A	11: 58,859,286	R429H	unknown	Het
Gm7247	T	G	14: 51,428,753		probably benign	Het
Gmppa	A	G	1: 75,438,288	Y59C	probably damaging	Het
Has1	G	T	17: 17,850,059	A200E	possibly damaging	Het
Hbs1l	T	C	10: 21,358,812	I588T	possibly damaging	Het
Helz2	A	G	2: 181,232,767	V1978A	possibly damaging	Het
Hoxb9	T	C	11: 96,274,731	Y209H	probably damaging	Het
Hps5	T	C	7: 46,771,921	D706G	probably benign	Het
Hydin	T	C	8: 110,309,088	V137A	probably benign	Het
Ifngr2	T	C	16: 91,562,959	I318T	probably benign	Het
Iqgap3	C	T	3: 88,113,225	T1290I	probably damaging	Het
Jrk	A	T	15: 74,707,139	V99E	probably benign	Het
Kalrn	G	A	16: 34,198,460	P1311S	probably benign	Het
Kalrn	G	A	16: 34,205,326	T931M	probably damaging	Het
Kirrel3	A	G	9: 34,939,265		probably benign	Het
Klk9	T	C	7: 43,794,358	F99L	possibly damaging	Het
Lamb3	T	C	1: 193,330,816	C450R	probably damaging	Het
Lyst	T	A	13: 13,641,076	S1182T	probably benign	Het
Map1a	T	C	2: 121,307,644	V2933A	probably damaging	Het
Map2k5	A	T	9: 63,343,385		probably null	Het
Mcm6	A	G	1: 128,355,511		probably null	Het
Mmp17	G	A	5: 129,606,314	V505M	probably damaging	Het
Mpped2	A	G	2: 106,744,720	D50G	probably damaging	Het
Mtf1	T	A	4: 124,821,230	L216*	probably null	Het
Obscn	T	C	11: 58,999,812	E7298G	unknown	Het
Olfr39	A	G	9: 20,286,062	D129G	probably damaging	Het
Olfr598	A	T	7: 103,329,005	H173L	possibly damaging	Het
Olfr679	T	C	7: 105,086,556	L280P	probably damaging	Het
Olfr775	T	C	10: 129,251,014	L160P	probably benign	Het
Pcnt	T	A	10: 76,408,841	E1135V	probably damaging	Het
Pgap3	A	T	11: 98,391,098	V129D	probably benign	Het
Polq	A	G	16: 37,040,507	N497S	probably benign	Het
Ppfia4	T	C	1: 134,299,384	T1138A		Het
Prickle4	A	G	17: 47,690,662	L32P		Het
Prl2c2	C	T	13: 12,997,311	G158R	probably damaging	Het
Psd3	A	G	8: 67,758,098	I752T	probably benign	Het
Sag	A	T	1: 87,828,436	Y255F	probably benign	Het
Scn7a	A	T	2: 66,675,855	D1563E	probably damaging	Het
Secisbp2	A	G	13: 51,683,368	N855S	probably benign	Het
Setd2	T	C	9: 110,592,399	V2011A	probably benign	Het
Slc30a6	T	C	17: 74,423,117	V334A	probably damaging	Het
Spen	A	G	4: 141,477,209	V1369A	unknown	Het
Stac2	T	C	11: 98,041,547	T207A	probably benign	Het
Syne2	T	C	12: 75,905,293	V445A	probably benign	Het
Tas2r131	C	A	6: 132,957,504	W114L	probably damaging	Het
Tgfbrap1	G	A	1: 43,049,799	R815*	probably null	Het
Trpv2	A	T	11: 62,590,286	I404L	probably benign	Het
Zfp236	G	A	18: 82,598,997	T1791M	probably damaging	Het

Other mutations in Pax2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01341:Pax2	APN	19	44790688	missense	probably damaging	0.99
IGL02368:Pax2	APN	19	44835409	missense	possibly damaging	0.55
IGL03146:Pax2	APN	19	44833275	splice site	probably benign
R0084:Pax2	UTSW	19	44818435	missense	probably damaging	1.00
R0554:Pax2	UTSW	19	44761861	missense	probably damaging	1.00
R1116:Pax2	UTSW	19	44757424	missense	probably damaging	0.99
R1951:Pax2	UTSW	19	44788832	missense	probably benign	0.09
R1952:Pax2	UTSW	19	44788832	missense	probably benign	0.09
R1981:Pax2	UTSW	19	44818465	missense	probably damaging	1.00
R3015:Pax2	UTSW	19	44816024	missense	probably damaging	1.00
R4320:Pax2	UTSW	19	44835399	missense	probably damaging	0.97
R4561:Pax2	UTSW	19	44835963	missense	unknown
R4562:Pax2	UTSW	19	44835963	missense	unknown
R4661:Pax2	UTSW	19	44760937	missense	probably damaging	1.00
R4948:Pax2	UTSW	19	44816040	missense	probably damaging	1.00
R5131:Pax2	UTSW	19	44760955	missense	probably damaging	0.98
R5622:Pax2	UTSW	19	44818466	missense	probably damaging	1.00
R5661:Pax2	UTSW	19	44790722	missense	probably damaging	1.00
R6110:Pax2	UTSW	19	44790736	missense	probably damaging	0.99
R6171:Pax2	UTSW	19	44790740	missense	probably damaging	1.00
R6713:Pax2	UTSW	19	44835477	missense	unknown
R6791:Pax2	UTSW	19	44788821	missense	possibly damaging	0.69
R7156:Pax2	UTSW	19	44788859	missense	probably benign	0.00
R7679:Pax2	UTSW	19	44760937	missense	probably damaging	1.00
R7695:Pax2	UTSW	19	44833199	missense	probably damaging	1.00
R8005:Pax2	UTSW	19	44760889	missense	probably damaging	1.00
R8555:Pax2	UTSW	19	44761689	missense	probably damaging	1.00
R8849:Pax2	UTSW	19	44760672	intron	probably benign
R9043:Pax2	UTSW	19	44816060	missense	probably benign	0.00
R9103:Pax2	UTSW	19	44818529	missense	probably benign	0.00
X0018:Pax2	UTSW	19	44796676	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GTGCTAAGTGGATTGCAGAGC -3'
(R):5'- GGAGGCACTGAACTAATACCAC -3'

Sequencing Primer
(F):5'- CTAAGTGGATTGCAGAGCAGACAG -3'
(R):5'- CCAGAGAGACCCTACGAGG -3'

Posted On

2021-07-15