Mutagenetix > Incidental Mutation

Incidental Mutation 'R8879:Lrrc8a'

676742

Institutional Source

Beutler Lab

Gene Symbol

Lrrc8a

Ensembl Gene

ENSMUSG00000007476

Gene Name

leucine rich repeat containing 8A

Synonyms

Lrrc8

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8879 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30237715-30263790 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30256298 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 375 (M375V)

Ref Sequence

ENSEMBL: ENSMUSP00000092690 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095078] [ENSMUST00000113654] [ENSMUST00000139454]

AlphaFold

Q80WG5

Predicted Effect

probably benign
Transcript: ENSMUST00000095078
AA Change: M375V

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000092690
Gene: ENSMUSG00000007476
AA Change: M375V

Domain	Start	End	E-Value	Type
Pfam:Pannexin_like	1	340	1.4e-146	PFAM
low complexity region	445	455	N/A	INTRINSIC
internal_repeat_1	461	526	7.6e-5	PROSPERO
low complexity region	540	558	N/A	INTRINSIC
LRR	590	613	5.41e0	SMART
LRR	614	636	3.18e2	SMART
LRR	638	660	6.78e1	SMART
LRR_TYP	661	684	1.06e-4	SMART
LRR	685	706	1.15e1	SMART
LRR_TYP	707	730	1.92e-2	SMART
LRR	731	751	1.81e2	SMART
LRR	753	776	2.02e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113654
AA Change: M375V

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000109284
Gene: ENSMUSG00000007476
AA Change: M375V

Domain	Start	End	E-Value	Type
Pfam:DUF3733	1	65	3.3e-32	PFAM
Pfam:DUF3733	97	156	2e-22	PFAM
transmembrane domain	320	342	N/A	INTRINSIC
low complexity region	445	455	N/A	INTRINSIC
internal_repeat_1	461	526	7.6e-5	PROSPERO
low complexity region	540	558	N/A	INTRINSIC
LRR	590	613	5.41e0	SMART
LRR	614	636	3.18e2	SMART
LRR	638	660	6.78e1	SMART
LRR_TYP	661	684	1.06e-4	SMART
LRR	685	706	1.15e1	SMART
LRR_TYP	707	730	1.92e-2	SMART
LRR	731	751	1.81e2	SMART
LRR	753	776	2.02e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000139454
AA Change: M375V

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000139038
Gene: ENSMUSG00000099041
AA Change: M375V

Domain	Start	End	E-Value	Type
Pfam:DUF3733	1	65	3.3e-32	PFAM
Pfam:DUF3733	97	156	2e-22	PFAM
transmembrane domain	320	342	N/A	INTRINSIC
low complexity region	445	455	N/A	INTRINSIC
internal_repeat_1	461	526	7.6e-5	PROSPERO
low complexity region	540	558	N/A	INTRINSIC
LRR	590	613	5.41e0	SMART
LRR	614	636	3.18e2	SMART
LRR	638	660	6.78e1	SMART
LRR_TYP	661	684	1.06e-4	SMART
LRR	685	706	1.15e1	SMART
LRR_TYP	707	730	1.92e-2	SMART
LRR	731	751	1.81e2	SMART
LRR	753	776	2.02e-1	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the leucine-rich repeat family of proteins, which are involved in diverse biological processes, including cell adhesion, cellular trafficking, and hormone-receptor interactions. This family member is a putative four-pass transmembrane protein that plays a role in B cell development. Defects in this gene cause autosomal dominant non-Bruton type agammaglobulinemia, an immunodeficiency disease resulting from defects in B cell maturation. Multiple alternatively spliced transcript variants, which encode the same protein, have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous for a knock-out allele exhibit prenatal lethality and premature death, growth retardation, sterility, multiple tissue abnormalities, a severe block in early thymic development, and impaired peripheral T cell function. B cell development is modestly impaired but B cell function is normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130401M01Rik	C	T	15: 58,022,509	V326M	probably damaging	Het
Adap2	T	A	11: 80,156,959	H80Q	probably benign	Het
Ang4	T	C	14: 51,764,486	T2A	probably benign	Het
Arf2	T	C	11: 103,979,759		probably null	Het
B3gnt4	A	G	5: 123,511,148	D192G	probably damaging	Het
BC034090	T	C	1: 155,226,357	I54V	probably benign	Het
Catsper3	A	G	13: 55,804,895	T202A	probably benign	Het
Cenpe	T	A	3: 135,260,101	D2113E	probably damaging	Het
Clasp2	T	C	9: 113,773,705	V191A	probably benign	Het
Col5a1	G	T	2: 28,014,158	A1356S	unknown	Het
Cuzd1	A	G	7: 131,308,848	S573P	probably damaging	Het
Cyp1a2	C	A	9: 57,681,885	M215I	possibly damaging	Het
Dcaf17	T	A	2: 71,063,402	I122K	possibly damaging	Het
Dhcr24	A	G	4: 106,573,809	I232V	probably benign	Het
Dnah10	A	G	5: 124,818,117	E3570G	probably damaging	Het
Dnaja4	A	T	9: 54,714,704		probably benign	Het
Ehd1	A	G	19: 6,298,324	D444G	probably damaging	Het
Ehmt1	T	A	2: 24,836,476	M766L	possibly damaging	Het
Eno4	A	G	19: 58,970,722	I613M	probably benign	Het
Exoc3l	A	T	8: 105,290,549	M602K		Het
Fam107a	C	T	14: 8,301,352		probably null	Het
Frem3	A	T	8: 80,613,148	D690V	probably damaging	Het
Gm11639	T	C	11: 104,690,955	I41T	probably benign	Het
Gm19410	A	T	8: 35,771,868	D97V	probably damaging	Het
Grik5	T	A	7: 25,023,064	D540V	possibly damaging	Het
Hint1	T	A	11: 54,869,943	D69E	probably benign	Het
Krt13	T	C	11: 100,119,385	T257A	probably benign	Het
Lpin2	T	C	17: 71,242,754	L676P	probably damaging	Het
Lrguk	A	G	6: 34,029,683	E76G	probably benign	Het
Lrrtm3	T	C	10: 64,089,238	Q50R	possibly damaging	Het
Mmrn1	T	A	6: 60,976,529	L598Q	probably damaging	Het
Mrs2	A	G	13: 25,001,784	I135T	probably damaging	Het
Neb	T	C	2: 52,235,580	D475G		Het
Notch2	A	G	3: 98,135,599	S1427G	possibly damaging	Het
Olfr118	C	A	17: 37,672,411	Y129*	probably null	Het
Olfr682-ps1	A	G	7: 105,126,686	V195A	probably benign	Het
Olfr694	A	T	7: 106,689,089	I214N	probably damaging	Het
Olfr816	A	G	10: 129,911,862	C139R	probably damaging	Het
Olfr952	A	C	9: 39,426,219	V284G	possibly damaging	Het
Opcml	T	C	9: 28,902,151	F246S	probably damaging	Het
Pdzd2	C	A	15: 12,402,319	V729F	probably damaging	Het
Pias2	C	T	18: 77,146,768	Q565*	probably null	Het
Pnp	T	A	14: 50,950,720		probably null	Het
Ptpn18	T	C	1: 34,463,130	S76P	probably benign	Het
Qtrt2	A	T	16: 43,863,197	L304Q	probably damaging	Het
Rad51ap2	A	T	12: 11,457,400	E441V	possibly damaging	Het
Ranbp2	T	A	10: 58,477,889	V1477E	probably benign	Het
Repin1	C	T	6: 48,597,433	T432I	possibly damaging	Het
Rest	G	A	5: 77,282,511	G926R	probably benign	Het
Rnft1	T	A	11: 86,486,690	F143L	possibly damaging	Het
Sema3e	A	T	5: 14,232,094	I415L	probably benign	Het
Slc10a1	T	A	12: 80,967,595	N117I	probably damaging	Het
Slc25a23	G	A	17: 57,059,709		probably benign	Het
Slc2a2	T	C	3: 28,713,802	S160P	possibly damaging	Het
Srrd	A	G	5: 112,338,456	V178A	possibly damaging	Het
Tmigd3	G	T	3: 105,921,961	G198C	probably benign	Het
Trbv29	G	A	6: 41,271,405	M1I	probably null	Het
Tril	A	G	6: 53,819,584	S218P	probably damaging	Het
Trip11	T	C	12: 101,862,598	K1749R	probably benign	Het
Ttc25	G	T	11: 100,566,926	E452*	probably null	Het
Ttn	A	G	2: 76,830,651	V12011A		Het
Ubr4	T	G	4: 139,410,518	F1093V	probably benign	Het
Urb2	C	A	8: 124,028,403	A283E	probably benign	Het
Usp43	T	A	11: 67,898,881		probably benign	Het
Vmn1r28	A	T	6: 58,265,684	I171F	probably benign	Het
Vps33a	G	A	5: 123,533,899	R469W	probably damaging	Het
Zfp202	G	A	9: 40,211,757	R605Q	probably damaging	Het
Zpbp2	A	T	11: 98,554,620	H158L	probably benign	Het

Other mutations in Lrrc8a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00693:Lrrc8a	APN	2	30255315	missense	probably benign	0.32
IGL01161:Lrrc8a	APN	2	30255810	missense	probably damaging	1.00
IGL01419:Lrrc8a	APN	2	30257099	missense	probably benign	0.09
IGL01757:Lrrc8a	APN	2	30255525	missense	possibly damaging	0.81
IGL02390:Lrrc8a	APN	2	30256701	missense	probably damaging	1.00
IGL02608:Lrrc8a	APN	2	30256299	missense	possibly damaging	0.91
IGL02938:Lrrc8a	APN	2	30255686	missense	probably damaging	1.00
IGL02960:Lrrc8a	APN	2	30257013	missense	probably damaging	1.00
IGL03139:Lrrc8a	APN	2	30255671	missense	probably damaging	1.00
IGL03166:Lrrc8a	APN	2	30255365	missense	probably benign
R0033:Lrrc8a	UTSW	2	30255345	missense	probably damaging	1.00
R0033:Lrrc8a	UTSW	2	30255345	missense	probably damaging	1.00
R0276:Lrrc8a	UTSW	2	30256788	missense	possibly damaging	0.54
R0432:Lrrc8a	UTSW	2	30257067	missense	probably damaging	1.00
R0751:Lrrc8a	UTSW	2	30256350	missense	possibly damaging	0.82
R1924:Lrrc8a	UTSW	2	30255250	missense	probably damaging	1.00
R2029:Lrrc8a	UTSW	2	30256649	missense	probably damaging	1.00
R3852:Lrrc8a	UTSW	2	30261960	missense	probably benign	0.30
R4898:Lrrc8a	UTSW	2	30257202	missense	probably benign	0.00
R5175:Lrrc8a	UTSW	2	30255512	missense	probably damaging	1.00
R5616:Lrrc8a	UTSW	2	30255354	missense	probably benign	0.09
R5874:Lrrc8a	UTSW	2	30257136	missense	probably damaging	1.00
R6228:Lrrc8a	UTSW	2	30256553	missense	possibly damaging	0.82
R6406:Lrrc8a	UTSW	2	30257091	missense	possibly damaging	0.56
R6456:Lrrc8a	UTSW	2	30255474	missense	probably benign	0.14
R6833:Lrrc8a	UTSW	2	30255647	missense	possibly damaging	0.92
R6834:Lrrc8a	UTSW	2	30255647	missense	possibly damaging	0.92
R6945:Lrrc8a	UTSW	2	30256227	missense	probably damaging	1.00
R7675:Lrrc8a	UTSW	2	30255668	missense	probably damaging	1.00
R8500:Lrrc8a	UTSW	2	30256196	missense	possibly damaging	0.65
R8528:Lrrc8a	UTSW	2	30255545	missense	probably damaging	1.00
R8734:Lrrc8a	UTSW	2	30256607	missense	probably benign	0.12
R9112:Lrrc8a	UTSW	2	30255770	missense	probably damaging	0.99
R9130:Lrrc8a	UTSW	2	30257030	missense	possibly damaging	0.82
R9456:Lrrc8a	UTSW	2	30255651	missense	probably damaging	1.00
Z1177:Lrrc8a	UTSW	2	30256313	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTCTTCAAGATCTTGGCATC -3'
(R):5'- TTCAGGACCTCGAGCTCAAC -3'

Sequencing Primer
(F):5'- AAGATCTTGGCATCCTTCTACATCAG -3'
(R):5'- ATGCCGCTGAGCATGAAC -3'

Posted On

2021-07-15