Incidental Mutation 'R8879:Lrrc8a'
ID 676742
Institutional Source Beutler Lab
Gene Symbol Lrrc8a
Ensembl Gene ENSMUSG00000007476
Gene Name leucine rich repeat containing 8A
Synonyms Lrrc8
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8879 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 30237715-30263790 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30256298 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 375 (M375V)
Ref Sequence ENSEMBL: ENSMUSP00000092690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095078] [ENSMUST00000113654] [ENSMUST00000139454]
AlphaFold Q80WG5
Predicted Effect probably benign
Transcript: ENSMUST00000095078
AA Change: M375V

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000092690
Gene: ENSMUSG00000007476
AA Change: M375V

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 340 1.4e-146 PFAM
low complexity region 445 455 N/A INTRINSIC
internal_repeat_1 461 526 7.6e-5 PROSPERO
low complexity region 540 558 N/A INTRINSIC
LRR 590 613 5.41e0 SMART
LRR 614 636 3.18e2 SMART
LRR 638 660 6.78e1 SMART
LRR_TYP 661 684 1.06e-4 SMART
LRR 685 706 1.15e1 SMART
LRR_TYP 707 730 1.92e-2 SMART
LRR 731 751 1.81e2 SMART
LRR 753 776 2.02e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113654
AA Change: M375V

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000109284
Gene: ENSMUSG00000007476
AA Change: M375V

DomainStartEndE-ValueType
Pfam:DUF3733 1 65 3.3e-32 PFAM
Pfam:DUF3733 97 156 2e-22 PFAM
transmembrane domain 320 342 N/A INTRINSIC
low complexity region 445 455 N/A INTRINSIC
internal_repeat_1 461 526 7.6e-5 PROSPERO
low complexity region 540 558 N/A INTRINSIC
LRR 590 613 5.41e0 SMART
LRR 614 636 3.18e2 SMART
LRR 638 660 6.78e1 SMART
LRR_TYP 661 684 1.06e-4 SMART
LRR 685 706 1.15e1 SMART
LRR_TYP 707 730 1.92e-2 SMART
LRR 731 751 1.81e2 SMART
LRR 753 776 2.02e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139454
AA Change: M375V

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139038
Gene: ENSMUSG00000099041
AA Change: M375V

DomainStartEndE-ValueType
Pfam:DUF3733 1 65 3.3e-32 PFAM
Pfam:DUF3733 97 156 2e-22 PFAM
transmembrane domain 320 342 N/A INTRINSIC
low complexity region 445 455 N/A INTRINSIC
internal_repeat_1 461 526 7.6e-5 PROSPERO
low complexity region 540 558 N/A INTRINSIC
LRR 590 613 5.41e0 SMART
LRR 614 636 3.18e2 SMART
LRR 638 660 6.78e1 SMART
LRR_TYP 661 684 1.06e-4 SMART
LRR 685 706 1.15e1 SMART
LRR_TYP 707 730 1.92e-2 SMART
LRR 731 751 1.81e2 SMART
LRR 753 776 2.02e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the leucine-rich repeat family of proteins, which are involved in diverse biological processes, including cell adhesion, cellular trafficking, and hormone-receptor interactions. This family member is a putative four-pass transmembrane protein that plays a role in B cell development. Defects in this gene cause autosomal dominant non-Bruton type agammaglobulinemia, an immunodeficiency disease resulting from defects in B cell maturation. Multiple alternatively spliced transcript variants, which encode the same protein, have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous for a knock-out allele exhibit prenatal lethality and premature death, growth retardation, sterility, multiple tissue abnormalities, a severe block in early thymic development, and impaired peripheral T cell function. B cell development is modestly impaired but B cell function is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C T 15: 58,022,509 V326M probably damaging Het
Adap2 T A 11: 80,156,959 H80Q probably benign Het
Ang4 T C 14: 51,764,486 T2A probably benign Het
Arf2 T C 11: 103,979,759 probably null Het
B3gnt4 A G 5: 123,511,148 D192G probably damaging Het
BC034090 T C 1: 155,226,357 I54V probably benign Het
Catsper3 A G 13: 55,804,895 T202A probably benign Het
Cenpe T A 3: 135,260,101 D2113E probably damaging Het
Clasp2 T C 9: 113,773,705 V191A probably benign Het
Col5a1 G T 2: 28,014,158 A1356S unknown Het
Cuzd1 A G 7: 131,308,848 S573P probably damaging Het
Cyp1a2 C A 9: 57,681,885 M215I possibly damaging Het
Dcaf17 T A 2: 71,063,402 I122K possibly damaging Het
Dhcr24 A G 4: 106,573,809 I232V probably benign Het
Dnah10 A G 5: 124,818,117 E3570G probably damaging Het
Dnaja4 A T 9: 54,714,704 probably benign Het
Ehd1 A G 19: 6,298,324 D444G probably damaging Het
Ehmt1 T A 2: 24,836,476 M766L possibly damaging Het
Eno4 A G 19: 58,970,722 I613M probably benign Het
Exoc3l A T 8: 105,290,549 M602K Het
Fam107a C T 14: 8,301,352 probably null Het
Frem3 A T 8: 80,613,148 D690V probably damaging Het
Gm11639 T C 11: 104,690,955 I41T probably benign Het
Gm19410 A T 8: 35,771,868 D97V probably damaging Het
Grik5 T A 7: 25,023,064 D540V possibly damaging Het
Hint1 T A 11: 54,869,943 D69E probably benign Het
Krt13 T C 11: 100,119,385 T257A probably benign Het
Lpin2 T C 17: 71,242,754 L676P probably damaging Het
Lrguk A G 6: 34,029,683 E76G probably benign Het
Lrrtm3 T C 10: 64,089,238 Q50R possibly damaging Het
Mmrn1 T A 6: 60,976,529 L598Q probably damaging Het
Mrs2 A G 13: 25,001,784 I135T probably damaging Het
Neb T C 2: 52,235,580 D475G Het
Notch2 A G 3: 98,135,599 S1427G possibly damaging Het
Olfr118 C A 17: 37,672,411 Y129* probably null Het
Olfr682-ps1 A G 7: 105,126,686 V195A probably benign Het
Olfr694 A T 7: 106,689,089 I214N probably damaging Het
Olfr816 A G 10: 129,911,862 C139R probably damaging Het
Olfr952 A C 9: 39,426,219 V284G possibly damaging Het
Opcml T C 9: 28,902,151 F246S probably damaging Het
Pdzd2 C A 15: 12,402,319 V729F probably damaging Het
Pias2 C T 18: 77,146,768 Q565* probably null Het
Pnp T A 14: 50,950,720 probably null Het
Ptpn18 T C 1: 34,463,130 S76P probably benign Het
Qtrt2 A T 16: 43,863,197 L304Q probably damaging Het
Rad51ap2 A T 12: 11,457,400 E441V possibly damaging Het
Ranbp2 T A 10: 58,477,889 V1477E probably benign Het
Repin1 C T 6: 48,597,433 T432I possibly damaging Het
Rest G A 5: 77,282,511 G926R probably benign Het
Rnft1 T A 11: 86,486,690 F143L possibly damaging Het
Sema3e A T 5: 14,232,094 I415L probably benign Het
Slc10a1 T A 12: 80,967,595 N117I probably damaging Het
Slc25a23 G A 17: 57,059,709 probably benign Het
Slc2a2 T C 3: 28,713,802 S160P possibly damaging Het
Srrd A G 5: 112,338,456 V178A possibly damaging Het
Tmigd3 G T 3: 105,921,961 G198C probably benign Het
Trbv29 G A 6: 41,271,405 M1I probably null Het
Tril A G 6: 53,819,584 S218P probably damaging Het
Trip11 T C 12: 101,862,598 K1749R probably benign Het
Ttc25 G T 11: 100,566,926 E452* probably null Het
Ttn A G 2: 76,830,651 V12011A Het
Ubr4 T G 4: 139,410,518 F1093V probably benign Het
Urb2 C A 8: 124,028,403 A283E probably benign Het
Usp43 T A 11: 67,898,881 probably benign Het
Vmn1r28 A T 6: 58,265,684 I171F probably benign Het
Vps33a G A 5: 123,533,899 R469W probably damaging Het
Zfp202 G A 9: 40,211,757 R605Q probably damaging Het
Zpbp2 A T 11: 98,554,620 H158L probably benign Het
Other mutations in Lrrc8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Lrrc8a APN 2 30255315 missense probably benign 0.32
IGL01161:Lrrc8a APN 2 30255810 missense probably damaging 1.00
IGL01419:Lrrc8a APN 2 30257099 missense probably benign 0.09
IGL01757:Lrrc8a APN 2 30255525 missense possibly damaging 0.81
IGL02390:Lrrc8a APN 2 30256701 missense probably damaging 1.00
IGL02608:Lrrc8a APN 2 30256299 missense possibly damaging 0.91
IGL02938:Lrrc8a APN 2 30255686 missense probably damaging 1.00
IGL02960:Lrrc8a APN 2 30257013 missense probably damaging 1.00
IGL03139:Lrrc8a APN 2 30255671 missense probably damaging 1.00
IGL03166:Lrrc8a APN 2 30255365 missense probably benign
R0033:Lrrc8a UTSW 2 30255345 missense probably damaging 1.00
R0033:Lrrc8a UTSW 2 30255345 missense probably damaging 1.00
R0276:Lrrc8a UTSW 2 30256788 missense possibly damaging 0.54
R0432:Lrrc8a UTSW 2 30257067 missense probably damaging 1.00
R0751:Lrrc8a UTSW 2 30256350 missense possibly damaging 0.82
R1924:Lrrc8a UTSW 2 30255250 missense probably damaging 1.00
R2029:Lrrc8a UTSW 2 30256649 missense probably damaging 1.00
R3852:Lrrc8a UTSW 2 30261960 missense probably benign 0.30
R4898:Lrrc8a UTSW 2 30257202 missense probably benign 0.00
R5175:Lrrc8a UTSW 2 30255512 missense probably damaging 1.00
R5616:Lrrc8a UTSW 2 30255354 missense probably benign 0.09
R5874:Lrrc8a UTSW 2 30257136 missense probably damaging 1.00
R6228:Lrrc8a UTSW 2 30256553 missense possibly damaging 0.82
R6406:Lrrc8a UTSW 2 30257091 missense possibly damaging 0.56
R6456:Lrrc8a UTSW 2 30255474 missense probably benign 0.14
R6833:Lrrc8a UTSW 2 30255647 missense possibly damaging 0.92
R6834:Lrrc8a UTSW 2 30255647 missense possibly damaging 0.92
R6945:Lrrc8a UTSW 2 30256227 missense probably damaging 1.00
R7675:Lrrc8a UTSW 2 30255668 missense probably damaging 1.00
R8500:Lrrc8a UTSW 2 30256196 missense possibly damaging 0.65
R8528:Lrrc8a UTSW 2 30255545 missense probably damaging 1.00
R8734:Lrrc8a UTSW 2 30256607 missense probably benign 0.12
R9112:Lrrc8a UTSW 2 30255770 missense probably damaging 0.99
R9130:Lrrc8a UTSW 2 30257030 missense possibly damaging 0.82
R9456:Lrrc8a UTSW 2 30255651 missense probably damaging 1.00
Z1177:Lrrc8a UTSW 2 30256313 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTTCAAGATCTTGGCATC -3'
(R):5'- TTCAGGACCTCGAGCTCAAC -3'

Sequencing Primer
(F):5'- AAGATCTTGGCATCCTTCTACATCAG -3'
(R):5'- ATGCCGCTGAGCATGAAC -3'
Posted On 2021-07-15