Incidental Mutation 'R8879:Slc2a2'
ID 676746
Institutional Source Beutler Lab
Gene Symbol Slc2a2
Ensembl Gene ENSMUSG00000027690
Gene Name solute carrier family 2 (facilitated glucose transporter), member 2
Synonyms liver-type glucose transporter, Glut2, Glut-2
MMRRC Submission 068747-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8879 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 28752052-28782510 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 28767951 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 160 (S160P)
Ref Sequence ENSEMBL: ENSMUSP00000029240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029240] [ENSMUST00000163536]
AlphaFold P14246
Predicted Effect possibly damaging
Transcript: ENSMUST00000029240
AA Change: S160P

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029240
Gene: ENSMUSG00000027690
AA Change: S160P

DomainStartEndE-ValueType
Pfam:MFS_1 9 442 4.2e-23 PFAM
Pfam:Sugar_tr 13 498 2.4e-165 PFAM
Pfam:Folate_carrier 187 458 5.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163536
SMART Domains Protein: ENSMUSP00000131046
Gene: ENSMUSG00000027690

DomainStartEndE-ValueType
Pfam:Sugar_tr 13 133 3.9e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral plasma membrane glycoprotein of the liver, islet beta cells, intestine, and kidney epithelium. The encoded protein mediates facilitated bidirectional glucose transport. Because of its low affinity for glucose, it has been suggested as a glucose sensor. Mutations in this gene are associated with susceptibility to diseases, including Fanconi-Bickel syndrome and noninsulin-dependent diabetes mellitus (NIDDM). Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous null mice are hyperglycemic with hypoinsulinemia and die within 2-3 weeks of life displaying increased plasma levels of glucagon, free fatty acids and beta-hydroxybutyrate, abnormal glucose tolerance, and altered postnatal development of pancreatic islets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C T 15: 57,885,905 (GRCm39) V326M probably damaging Het
Adap2 T A 11: 80,047,785 (GRCm39) H80Q probably benign Het
Ang4 T C 14: 52,001,943 (GRCm39) T2A probably benign Het
Arf2 T C 11: 103,870,585 (GRCm39) probably null Het
B3gnt4 A G 5: 123,649,211 (GRCm39) D192G probably damaging Het
BC034090 T C 1: 155,102,103 (GRCm39) I54V probably benign Het
Catsper3 A G 13: 55,952,708 (GRCm39) T202A probably benign Het
Cenpe T A 3: 134,965,862 (GRCm39) D2113E probably damaging Het
Clasp2 T C 9: 113,602,773 (GRCm39) V191A probably benign Het
Col5a1 G T 2: 27,904,170 (GRCm39) A1356S unknown Het
Cuzd1 A G 7: 130,910,577 (GRCm39) S573P probably damaging Het
Cyp1a2 C A 9: 57,589,168 (GRCm39) M215I possibly damaging Het
Dcaf17 T A 2: 70,893,746 (GRCm39) I122K possibly damaging Het
Dhcr24 A G 4: 106,431,006 (GRCm39) I232V probably benign Het
Dnah10 A G 5: 124,895,181 (GRCm39) E3570G probably damaging Het
Dnaja4 A T 9: 54,621,988 (GRCm39) probably benign Het
Efcab3 T C 11: 104,581,781 (GRCm39) I41T probably benign Het
Ehd1 A G 19: 6,348,354 (GRCm39) D444G probably damaging Het
Ehmt1 T A 2: 24,726,488 (GRCm39) M766L possibly damaging Het
Eno4 A G 19: 58,959,154 (GRCm39) I613M probably benign Het
Exoc3l A T 8: 106,017,181 (GRCm39) M602K Het
Fam107a C T 14: 8,301,352 (GRCm38) probably null Het
Frem3 A T 8: 81,339,777 (GRCm39) D690V probably damaging Het
Gm19410 A T 8: 36,239,022 (GRCm39) D97V probably damaging Het
Grik5 T A 7: 24,722,489 (GRCm39) D540V possibly damaging Het
Hint1 T A 11: 54,760,769 (GRCm39) D69E probably benign Het
Krt13 T C 11: 100,010,211 (GRCm39) T257A probably benign Het
Lpin2 T C 17: 71,549,749 (GRCm39) L676P probably damaging Het
Lrguk A G 6: 34,006,618 (GRCm39) E76G probably benign Het
Lrrc8a A G 2: 30,146,310 (GRCm39) M375V probably benign Het
Lrrtm3 T C 10: 63,925,017 (GRCm39) Q50R possibly damaging Het
Mmrn1 T A 6: 60,953,513 (GRCm39) L598Q probably damaging Het
Mrs2 A G 13: 25,185,767 (GRCm39) I135T probably damaging Het
Neb T C 2: 52,125,592 (GRCm39) D475G Het
Notch2 A G 3: 98,042,915 (GRCm39) S1427G possibly damaging Het
Odad4 G T 11: 100,457,752 (GRCm39) E452* probably null Het
Opcml T C 9: 28,813,447 (GRCm39) F246S probably damaging Het
Or10al2 C A 17: 37,983,302 (GRCm39) Y129* probably null Het
Or2ag1b A T 7: 106,288,296 (GRCm39) I214N probably damaging Het
Or56a42-ps1 A G 7: 104,775,893 (GRCm39) V195A probably benign Het
Or6c69 A G 10: 129,747,731 (GRCm39) C139R probably damaging Het
Or8g33 A C 9: 39,337,515 (GRCm39) V284G possibly damaging Het
Pdzd2 C A 15: 12,402,405 (GRCm39) V729F probably damaging Het
Pias2 C T 18: 77,234,464 (GRCm39) Q565* probably null Het
Pnp T A 14: 51,188,177 (GRCm39) probably null Het
Ptpn18 T C 1: 34,502,211 (GRCm39) S76P probably benign Het
Qtrt2 A T 16: 43,683,560 (GRCm39) L304Q probably damaging Het
Rad51ap2 A T 12: 11,507,401 (GRCm39) E441V possibly damaging Het
Ranbp2 T A 10: 58,313,711 (GRCm39) V1477E probably benign Het
Repin1 C T 6: 48,574,367 (GRCm39) T432I possibly damaging Het
Rest G A 5: 77,430,358 (GRCm39) G926R probably benign Het
Rnft1 T A 11: 86,377,516 (GRCm39) F143L possibly damaging Het
Sema3e A T 5: 14,282,108 (GRCm39) I415L probably benign Het
Slc10a1 T A 12: 81,014,369 (GRCm39) N117I probably damaging Het
Slc25a23 G A 17: 57,366,709 (GRCm39) probably benign Het
Srrd A G 5: 112,486,322 (GRCm39) V178A possibly damaging Het
Tmigd3 G T 3: 105,829,277 (GRCm39) G198C probably benign Het
Trbv28 G A 6: 41,248,339 (GRCm39) M1I probably null Het
Tril A G 6: 53,796,569 (GRCm39) S218P probably damaging Het
Trip11 T C 12: 101,828,857 (GRCm39) K1749R probably benign Het
Ttn A G 2: 76,660,995 (GRCm39) V12011A Het
Ubr4 T G 4: 139,137,829 (GRCm39) F1093V probably benign Het
Urb2 C A 8: 124,755,142 (GRCm39) A283E probably benign Het
Usp43 T A 11: 67,789,707 (GRCm39) probably benign Het
Vmn1r28 A T 6: 58,242,669 (GRCm39) I171F probably benign Het
Vps33a G A 5: 123,671,962 (GRCm39) R469W probably damaging Het
Zfp202 G A 9: 40,123,053 (GRCm39) R605Q probably damaging Het
Zpbp2 A T 11: 98,445,446 (GRCm39) H158L probably benign Het
Other mutations in Slc2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Slc2a2 APN 3 28,772,890 (GRCm39) missense possibly damaging 0.86
IGL01582:Slc2a2 APN 3 28,762,637 (GRCm39) missense probably benign 0.01
IGL01762:Slc2a2 APN 3 28,771,621 (GRCm39) missense probably damaging 1.00
IGL01942:Slc2a2 APN 3 28,759,952 (GRCm39) missense probably damaging 1.00
IGL02128:Slc2a2 APN 3 28,773,550 (GRCm39) missense probably damaging 1.00
IGL02218:Slc2a2 APN 3 28,752,174 (GRCm39) missense possibly damaging 0.94
IGL02278:Slc2a2 APN 3 28,771,604 (GRCm39) missense probably damaging 0.99
IGL02507:Slc2a2 APN 3 28,781,260 (GRCm39) missense probably benign 0.00
IGL02649:Slc2a2 APN 3 28,772,885 (GRCm39) missense probably damaging 0.97
IGL03323:Slc2a2 APN 3 28,780,439 (GRCm39) missense probably damaging 1.00
IGL03147:Slc2a2 UTSW 3 28,773,519 (GRCm39) missense possibly damaging 0.56
R0063:Slc2a2 UTSW 3 28,771,589 (GRCm39) missense probably damaging 0.98
R0063:Slc2a2 UTSW 3 28,771,589 (GRCm39) missense probably damaging 0.98
R0365:Slc2a2 UTSW 3 28,762,828 (GRCm39) critical splice donor site probably null
R0494:Slc2a2 UTSW 3 28,781,426 (GRCm39) missense probably benign 0.01
R0519:Slc2a2 UTSW 3 28,772,965 (GRCm39) missense possibly damaging 0.54
R1292:Slc2a2 UTSW 3 28,771,637 (GRCm39) missense probably damaging 1.00
R1755:Slc2a2 UTSW 3 28,767,811 (GRCm39) splice site probably null
R1965:Slc2a2 UTSW 3 28,773,634 (GRCm39) missense probably damaging 1.00
R1966:Slc2a2 UTSW 3 28,773,634 (GRCm39) missense probably damaging 1.00
R1982:Slc2a2 UTSW 3 28,771,590 (GRCm39) missense probably benign 0.36
R2937:Slc2a2 UTSW 3 28,772,920 (GRCm39) missense probably damaging 1.00
R3121:Slc2a2 UTSW 3 28,775,898 (GRCm39) missense probably benign 0.01
R3721:Slc2a2 UTSW 3 28,781,301 (GRCm39) missense probably damaging 1.00
R4799:Slc2a2 UTSW 3 28,771,681 (GRCm39) critical splice donor site probably null
R5206:Slc2a2 UTSW 3 28,762,756 (GRCm39) missense probably damaging 1.00
R6829:Slc2a2 UTSW 3 28,781,590 (GRCm39) nonsense probably null
R6864:Slc2a2 UTSW 3 28,775,874 (GRCm39) missense probably damaging 1.00
R6932:Slc2a2 UTSW 3 28,771,668 (GRCm39) missense probably benign 0.40
R7178:Slc2a2 UTSW 3 28,773,631 (GRCm39) missense possibly damaging 0.90
R7599:Slc2a2 UTSW 3 28,752,166 (GRCm39) start codon destroyed probably null 0.02
R7616:Slc2a2 UTSW 3 28,781,260 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGCATGACCAGGAACTAGC -3'
(R):5'- AGATGATGTCACAACTCACTCTTAC -3'

Sequencing Primer
(F):5'- GGCATGACCAGGAACTAGCTTTTTAG -3'
(R):5'- TCTTACTGTGCCATAGACACAG -3'
Posted On 2021-07-15