Mutagenetix > Incidental Mutation

Incidental Mutation 'R8879:Slc2a2'

676746

Institutional Source

Beutler Lab

Gene Symbol

Slc2a2

Ensembl Gene

ENSMUSG00000027690

Gene Name

solute carrier family 2 (facilitated glucose transporter), member 2

Synonyms

Glut2, liver-type glucose transporter, Glut-2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8879 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

28697903-28731359 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 28713802 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 160 (S160P)

Ref Sequence

ENSEMBL: ENSMUSP00000029240 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029240] [ENSMUST00000163536]

AlphaFold

P14246

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029240
AA Change: S160P

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000029240
Gene: ENSMUSG00000027690
AA Change: S160P

Domain	Start	End	E-Value	Type
Pfam:MFS_1	9	442	4.2e-23	PFAM
Pfam:Sugar_tr	13	498	2.4e-165	PFAM
Pfam:Folate_carrier	187	458	5.3e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163536

SMART Domains

Protein: ENSMUSP00000131046
Gene: ENSMUSG00000027690

Domain	Start	End	E-Value	Type
Pfam:Sugar_tr	13	133	3.9e-19	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral plasma membrane glycoprotein of the liver, islet beta cells, intestine, and kidney epithelium. The encoded protein mediates facilitated bidirectional glucose transport. Because of its low affinity for glucose, it has been suggested as a glucose sensor. Mutations in this gene are associated with susceptibility to diseases, including Fanconi-Bickel syndrome and noninsulin-dependent diabetes mellitus (NIDDM). Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous null mice are hyperglycemic with hypoinsulinemia and die within 2-3 weeks of life displaying increased plasma levels of glucagon, free fatty acids and beta-hydroxybutyrate, abnormal glucose tolerance, and altered postnatal development of pancreatic islets. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130401M01Rik	C	T	15: 58,022,509	V326M	probably damaging	Het
Adap2	T	A	11: 80,156,959	H80Q	probably benign	Het
Ang4	T	C	14: 51,764,486	T2A	probably benign	Het
Arf2	T	C	11: 103,979,759		probably null	Het
B3gnt4	A	G	5: 123,511,148	D192G	probably damaging	Het
BC034090	T	C	1: 155,226,357	I54V	probably benign	Het
Catsper3	A	G	13: 55,804,895	T202A	probably benign	Het
Cenpe	T	A	3: 135,260,101	D2113E	probably damaging	Het
Clasp2	T	C	9: 113,773,705	V191A	probably benign	Het
Col5a1	G	T	2: 28,014,158	A1356S	unknown	Het
Cuzd1	A	G	7: 131,308,848	S573P	probably damaging	Het
Cyp1a2	C	A	9: 57,681,885	M215I	possibly damaging	Het
Dcaf17	T	A	2: 71,063,402	I122K	possibly damaging	Het
Dhcr24	A	G	4: 106,573,809	I232V	probably benign	Het
Dnah10	A	G	5: 124,818,117	E3570G	probably damaging	Het
Dnaja4	A	T	9: 54,714,704		probably benign	Het
Ehd1	A	G	19: 6,298,324	D444G	probably damaging	Het
Ehmt1	T	A	2: 24,836,476	M766L	possibly damaging	Het
Eno4	A	G	19: 58,970,722	I613M	probably benign	Het
Exoc3l	A	T	8: 105,290,549	M602K		Het
Fam107a	C	T	14: 8,301,352		probably null	Het
Frem3	A	T	8: 80,613,148	D690V	probably damaging	Het
Gm11639	T	C	11: 104,690,955	I41T	probably benign	Het
Gm19410	A	T	8: 35,771,868	D97V	probably damaging	Het
Grik5	T	A	7: 25,023,064	D540V	possibly damaging	Het
Hint1	T	A	11: 54,869,943	D69E	probably benign	Het
Krt13	T	C	11: 100,119,385	T257A	probably benign	Het
Lpin2	T	C	17: 71,242,754	L676P	probably damaging	Het
Lrguk	A	G	6: 34,029,683	E76G	probably benign	Het
Lrrc8a	A	G	2: 30,256,298	M375V	probably benign	Het
Lrrtm3	T	C	10: 64,089,238	Q50R	possibly damaging	Het
Mmrn1	T	A	6: 60,976,529	L598Q	probably damaging	Het
Mrs2	A	G	13: 25,001,784	I135T	probably damaging	Het
Neb	T	C	2: 52,235,580	D475G		Het
Notch2	A	G	3: 98,135,599	S1427G	possibly damaging	Het
Olfr118	C	A	17: 37,672,411	Y129*	probably null	Het
Olfr682-ps1	A	G	7: 105,126,686	V195A	probably benign	Het
Olfr694	A	T	7: 106,689,089	I214N	probably damaging	Het
Olfr816	A	G	10: 129,911,862	C139R	probably damaging	Het
Olfr952	A	C	9: 39,426,219	V284G	possibly damaging	Het
Opcml	T	C	9: 28,902,151	F246S	probably damaging	Het
Pdzd2	C	A	15: 12,402,319	V729F	probably damaging	Het
Pias2	C	T	18: 77,146,768	Q565*	probably null	Het
Pnp	T	A	14: 50,950,720		probably null	Het
Ptpn18	T	C	1: 34,463,130	S76P	probably benign	Het
Qtrt2	A	T	16: 43,863,197	L304Q	probably damaging	Het
Rad51ap2	A	T	12: 11,457,400	E441V	possibly damaging	Het
Ranbp2	T	A	10: 58,477,889	V1477E	probably benign	Het
Repin1	C	T	6: 48,597,433	T432I	possibly damaging	Het
Rest	G	A	5: 77,282,511	G926R	probably benign	Het
Rnft1	T	A	11: 86,486,690	F143L	possibly damaging	Het
Sema3e	A	T	5: 14,232,094	I415L	probably benign	Het
Slc10a1	T	A	12: 80,967,595	N117I	probably damaging	Het
Slc25a23	G	A	17: 57,059,709		probably benign	Het
Srrd	A	G	5: 112,338,456	V178A	possibly damaging	Het
Tmigd3	G	T	3: 105,921,961	G198C	probably benign	Het
Trbv29	G	A	6: 41,271,405	M1I	probably null	Het
Tril	A	G	6: 53,819,584	S218P	probably damaging	Het
Trip11	T	C	12: 101,862,598	K1749R	probably benign	Het
Ttc25	G	T	11: 100,566,926	E452*	probably null	Het
Ttn	A	G	2: 76,830,651	V12011A		Het
Ubr4	T	G	4: 139,410,518	F1093V	probably benign	Het
Urb2	C	A	8: 124,028,403	A283E	probably benign	Het
Usp43	T	A	11: 67,898,881		probably benign	Het
Vmn1r28	A	T	6: 58,265,684	I171F	probably benign	Het
Vps33a	G	A	5: 123,533,899	R469W	probably damaging	Het
Zfp202	G	A	9: 40,211,757	R605Q	probably damaging	Het
Zpbp2	A	T	11: 98,554,620	H158L	probably benign	Het

Other mutations in Slc2a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00836:Slc2a2	APN	3	28718741	missense	possibly damaging	0.86
IGL01582:Slc2a2	APN	3	28708488	missense	probably benign	0.01
IGL01762:Slc2a2	APN	3	28717472	missense	probably damaging	1.00
IGL01942:Slc2a2	APN	3	28705803	missense	probably damaging	1.00
IGL02128:Slc2a2	APN	3	28719401	missense	probably damaging	1.00
IGL02218:Slc2a2	APN	3	28698025	missense	possibly damaging	0.94
IGL02278:Slc2a2	APN	3	28717455	missense	probably damaging	0.99
IGL02507:Slc2a2	APN	3	28727111	missense	probably benign	0.00
IGL02649:Slc2a2	APN	3	28718736	missense	probably damaging	0.97
IGL03323:Slc2a2	APN	3	28726290	missense	probably damaging	1.00
IGL03147:Slc2a2	UTSW	3	28719370	missense	possibly damaging	0.56
R0063:Slc2a2	UTSW	3	28717440	missense	probably damaging	0.98
R0063:Slc2a2	UTSW	3	28717440	missense	probably damaging	0.98
R0365:Slc2a2	UTSW	3	28708679	critical splice donor site	probably null
R0494:Slc2a2	UTSW	3	28727277	missense	probably benign	0.01
R0519:Slc2a2	UTSW	3	28718816	missense	possibly damaging	0.54
R1292:Slc2a2	UTSW	3	28717488	missense	probably damaging	1.00
R1755:Slc2a2	UTSW	3	28713662	splice site	probably null
R1965:Slc2a2	UTSW	3	28719485	missense	probably damaging	1.00
R1966:Slc2a2	UTSW	3	28719485	missense	probably damaging	1.00
R1982:Slc2a2	UTSW	3	28717441	missense	probably benign	0.36
R2937:Slc2a2	UTSW	3	28718771	missense	probably damaging	1.00
R3121:Slc2a2	UTSW	3	28721749	missense	probably benign	0.01
R3721:Slc2a2	UTSW	3	28727152	missense	probably damaging	1.00
R4799:Slc2a2	UTSW	3	28717532	critical splice donor site	probably null
R5206:Slc2a2	UTSW	3	28708607	missense	probably damaging	1.00
R6829:Slc2a2	UTSW	3	28727441	nonsense	probably null
R6864:Slc2a2	UTSW	3	28721725	missense	probably damaging	1.00
R6932:Slc2a2	UTSW	3	28717519	missense	probably benign	0.40
R7178:Slc2a2	UTSW	3	28719482	missense	possibly damaging	0.90
R7599:Slc2a2	UTSW	3	28698017	start codon destroyed	probably null	0.02
R7616:Slc2a2	UTSW	3	28727111	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGGCATGACCAGGAACTAGC -3'
(R):5'- AGATGATGTCACAACTCACTCTTAC -3'

Sequencing Primer
(F):5'- GGCATGACCAGGAACTAGCTTTTTAG -3'
(R):5'- TCTTACTGTGCCATAGACACAG -3'

Posted On

2021-07-15