Incidental Mutation 'R8879:Cenpe'
ID 676749
Institutional Source Beutler Lab
Gene Symbol Cenpe
Ensembl Gene ENSMUSG00000045328
Gene Name centromere protein E
Synonyms 312kDa, Kif10, N-7 kinesin, CENP-E
MMRRC Submission 068747-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8879 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 134918324-134979301 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 134965862 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 2113 (D2113E)
Ref Sequence ENSEMBL: ENSMUSP00000057938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062893]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000062893
AA Change: D2113E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328
AA Change: D2113E

DomainStartEndE-ValueType
KISc 4 337 2.4e-172 SMART
coiled coil region 493 612 N/A INTRINSIC
coiled coil region 637 752 N/A INTRINSIC
internal_repeat_1 768 801 3.5e-5 PROSPERO
coiled coil region 821 991 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
internal_repeat_2 1225 1238 6.26e-5 PROSPERO
low complexity region 1446 1467 N/A INTRINSIC
low complexity region 1480 1498 N/A INTRINSIC
internal_repeat_2 1614 1627 6.26e-5 PROSPERO
internal_repeat_1 2018 2051 3.5e-5 PROSPERO
coiled coil region 2226 2247 N/A INTRINSIC
coiled coil region 2316 2363 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C T 15: 57,885,905 (GRCm39) V326M probably damaging Het
Adap2 T A 11: 80,047,785 (GRCm39) H80Q probably benign Het
Ang4 T C 14: 52,001,943 (GRCm39) T2A probably benign Het
Arf2 T C 11: 103,870,585 (GRCm39) probably null Het
B3gnt4 A G 5: 123,649,211 (GRCm39) D192G probably damaging Het
BC034090 T C 1: 155,102,103 (GRCm39) I54V probably benign Het
Catsper3 A G 13: 55,952,708 (GRCm39) T202A probably benign Het
Clasp2 T C 9: 113,602,773 (GRCm39) V191A probably benign Het
Col5a1 G T 2: 27,904,170 (GRCm39) A1356S unknown Het
Cuzd1 A G 7: 130,910,577 (GRCm39) S573P probably damaging Het
Cyp1a2 C A 9: 57,589,168 (GRCm39) M215I possibly damaging Het
Dcaf17 T A 2: 70,893,746 (GRCm39) I122K possibly damaging Het
Dhcr24 A G 4: 106,431,006 (GRCm39) I232V probably benign Het
Dnah10 A G 5: 124,895,181 (GRCm39) E3570G probably damaging Het
Dnaja4 A T 9: 54,621,988 (GRCm39) probably benign Het
Efcab3 T C 11: 104,581,781 (GRCm39) I41T probably benign Het
Ehd1 A G 19: 6,348,354 (GRCm39) D444G probably damaging Het
Ehmt1 T A 2: 24,726,488 (GRCm39) M766L possibly damaging Het
Eno4 A G 19: 58,959,154 (GRCm39) I613M probably benign Het
Exoc3l A T 8: 106,017,181 (GRCm39) M602K Het
Fam107a C T 14: 8,301,352 (GRCm38) probably null Het
Frem3 A T 8: 81,339,777 (GRCm39) D690V probably damaging Het
Gm19410 A T 8: 36,239,022 (GRCm39) D97V probably damaging Het
Grik5 T A 7: 24,722,489 (GRCm39) D540V possibly damaging Het
Hint1 T A 11: 54,760,769 (GRCm39) D69E probably benign Het
Krt13 T C 11: 100,010,211 (GRCm39) T257A probably benign Het
Lpin2 T C 17: 71,549,749 (GRCm39) L676P probably damaging Het
Lrguk A G 6: 34,006,618 (GRCm39) E76G probably benign Het
Lrrc8a A G 2: 30,146,310 (GRCm39) M375V probably benign Het
Lrrtm3 T C 10: 63,925,017 (GRCm39) Q50R possibly damaging Het
Mmrn1 T A 6: 60,953,513 (GRCm39) L598Q probably damaging Het
Mrs2 A G 13: 25,185,767 (GRCm39) I135T probably damaging Het
Neb T C 2: 52,125,592 (GRCm39) D475G Het
Notch2 A G 3: 98,042,915 (GRCm39) S1427G possibly damaging Het
Odad4 G T 11: 100,457,752 (GRCm39) E452* probably null Het
Opcml T C 9: 28,813,447 (GRCm39) F246S probably damaging Het
Or10al2 C A 17: 37,983,302 (GRCm39) Y129* probably null Het
Or2ag1b A T 7: 106,288,296 (GRCm39) I214N probably damaging Het
Or56a42-ps1 A G 7: 104,775,893 (GRCm39) V195A probably benign Het
Or6c69 A G 10: 129,747,731 (GRCm39) C139R probably damaging Het
Or8g33 A C 9: 39,337,515 (GRCm39) V284G possibly damaging Het
Pdzd2 C A 15: 12,402,405 (GRCm39) V729F probably damaging Het
Pias2 C T 18: 77,234,464 (GRCm39) Q565* probably null Het
Pnp T A 14: 51,188,177 (GRCm39) probably null Het
Ptpn18 T C 1: 34,502,211 (GRCm39) S76P probably benign Het
Qtrt2 A T 16: 43,683,560 (GRCm39) L304Q probably damaging Het
Rad51ap2 A T 12: 11,507,401 (GRCm39) E441V possibly damaging Het
Ranbp2 T A 10: 58,313,711 (GRCm39) V1477E probably benign Het
Repin1 C T 6: 48,574,367 (GRCm39) T432I possibly damaging Het
Rest G A 5: 77,430,358 (GRCm39) G926R probably benign Het
Rnft1 T A 11: 86,377,516 (GRCm39) F143L possibly damaging Het
Sema3e A T 5: 14,282,108 (GRCm39) I415L probably benign Het
Slc10a1 T A 12: 81,014,369 (GRCm39) N117I probably damaging Het
Slc25a23 G A 17: 57,366,709 (GRCm39) probably benign Het
Slc2a2 T C 3: 28,767,951 (GRCm39) S160P possibly damaging Het
Srrd A G 5: 112,486,322 (GRCm39) V178A possibly damaging Het
Tmigd3 G T 3: 105,829,277 (GRCm39) G198C probably benign Het
Trbv28 G A 6: 41,248,339 (GRCm39) M1I probably null Het
Tril A G 6: 53,796,569 (GRCm39) S218P probably damaging Het
Trip11 T C 12: 101,828,857 (GRCm39) K1749R probably benign Het
Ttn A G 2: 76,660,995 (GRCm39) V12011A Het
Ubr4 T G 4: 139,137,829 (GRCm39) F1093V probably benign Het
Urb2 C A 8: 124,755,142 (GRCm39) A283E probably benign Het
Usp43 T A 11: 67,789,707 (GRCm39) probably benign Het
Vmn1r28 A T 6: 58,242,669 (GRCm39) I171F probably benign Het
Vps33a G A 5: 123,671,962 (GRCm39) R469W probably damaging Het
Zfp202 G A 9: 40,123,053 (GRCm39) R605Q probably damaging Het
Zpbp2 A T 11: 98,445,446 (GRCm39) H158L probably benign Het
Other mutations in Cenpe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Cenpe APN 3 134,937,216 (GRCm39) critical splice donor site probably null
IGL00799:Cenpe APN 3 134,934,678 (GRCm39) critical splice donor site probably null
IGL00815:Cenpe APN 3 134,965,112 (GRCm39) missense probably benign
IGL01446:Cenpe APN 3 134,943,300 (GRCm39) missense probably benign 0.01
IGL01469:Cenpe APN 3 134,934,567 (GRCm39) missense probably damaging 1.00
IGL01843:Cenpe APN 3 134,924,268 (GRCm39) missense possibly damaging 0.88
IGL02254:Cenpe APN 3 134,961,238 (GRCm39) missense probably benign
IGL02337:Cenpe APN 3 134,926,037 (GRCm39) splice site probably benign
IGL02382:Cenpe APN 3 134,953,147 (GRCm39) missense probably benign
IGL02458:Cenpe APN 3 134,935,869 (GRCm39) nonsense probably null
IGL02934:Cenpe APN 3 134,970,112 (GRCm39) missense probably damaging 1.00
IGL03335:Cenpe APN 3 134,949,386 (GRCm39) missense probably benign
R0086:Cenpe UTSW 3 134,970,185 (GRCm39) splice site probably benign
R0173:Cenpe UTSW 3 134,965,744 (GRCm39) missense probably benign 0.00
R0394:Cenpe UTSW 3 134,922,186 (GRCm39) splice site probably benign
R0411:Cenpe UTSW 3 134,928,016 (GRCm39) missense probably damaging 1.00
R0624:Cenpe UTSW 3 134,952,347 (GRCm39) missense probably benign 0.00
R0634:Cenpe UTSW 3 134,952,588 (GRCm39) missense probably damaging 1.00
R0648:Cenpe UTSW 3 134,935,843 (GRCm39) missense probably damaging 1.00
R0691:Cenpe UTSW 3 134,923,066 (GRCm39) missense probably damaging 1.00
R1184:Cenpe UTSW 3 134,970,183 (GRCm39) critical splice donor site probably null
R1530:Cenpe UTSW 3 134,952,663 (GRCm39) missense possibly damaging 0.92
R1559:Cenpe UTSW 3 134,976,661 (GRCm39) missense probably benign 0.07
R1562:Cenpe UTSW 3 134,944,155 (GRCm39) missense possibly damaging 0.53
R1568:Cenpe UTSW 3 134,945,519 (GRCm39) missense probably benign 0.01
R1712:Cenpe UTSW 3 134,971,694 (GRCm39) missense probably damaging 0.99
R1828:Cenpe UTSW 3 134,952,257 (GRCm39) missense probably damaging 0.99
R1846:Cenpe UTSW 3 134,945,606 (GRCm39) missense probably damaging 1.00
R1861:Cenpe UTSW 3 134,974,740 (GRCm39) missense probably damaging 1.00
R1938:Cenpe UTSW 3 134,953,240 (GRCm39) missense probably damaging 0.98
R1961:Cenpe UTSW 3 134,948,254 (GRCm39) missense probably damaging 1.00
R2062:Cenpe UTSW 3 134,928,082 (GRCm39) splice site probably benign
R2118:Cenpe UTSW 3 134,952,645 (GRCm39) missense possibly damaging 0.94
R2127:Cenpe UTSW 3 134,945,541 (GRCm39) missense probably benign 0.08
R2156:Cenpe UTSW 3 134,953,235 (GRCm39) missense probably benign 0.34
R2265:Cenpe UTSW 3 134,967,397 (GRCm39) missense probably benign 0.02
R2268:Cenpe UTSW 3 134,967,397 (GRCm39) missense probably benign 0.02
R2392:Cenpe UTSW 3 134,953,874 (GRCm39) missense probably damaging 1.00
R2508:Cenpe UTSW 3 134,946,834 (GRCm39) missense possibly damaging 0.92
R3084:Cenpe UTSW 3 134,946,782 (GRCm39) missense probably damaging 1.00
R3779:Cenpe UTSW 3 134,962,337 (GRCm39) missense possibly damaging 0.87
R3833:Cenpe UTSW 3 134,928,083 (GRCm39) splice site probably benign
R3974:Cenpe UTSW 3 134,940,986 (GRCm39) splice site probably null
R3975:Cenpe UTSW 3 134,944,233 (GRCm39) critical splice donor site probably null
R3975:Cenpe UTSW 3 134,940,986 (GRCm39) splice site probably null
R4151:Cenpe UTSW 3 134,920,914 (GRCm39) missense probably benign 0.36
R4166:Cenpe UTSW 3 134,949,479 (GRCm39) missense probably damaging 1.00
R4581:Cenpe UTSW 3 134,952,761 (GRCm39) missense probably benign 0.30
R4622:Cenpe UTSW 3 134,949,469 (GRCm39) missense probably benign 0.22
R4692:Cenpe UTSW 3 134,922,140 (GRCm39) missense probably benign 0.29
R4769:Cenpe UTSW 3 134,953,912 (GRCm39) missense probably benign
R4976:Cenpe UTSW 3 134,940,637 (GRCm39) missense probably damaging 1.00
R4983:Cenpe UTSW 3 134,940,689 (GRCm39) missense probably damaging 1.00
R4990:Cenpe UTSW 3 134,962,401 (GRCm39) missense probably damaging 1.00
R5002:Cenpe UTSW 3 134,952,842 (GRCm39) missense probably benign
R5057:Cenpe UTSW 3 134,926,074 (GRCm39) missense probably benign 0.14
R5063:Cenpe UTSW 3 134,976,715 (GRCm39) missense probably damaging 0.99
R5181:Cenpe UTSW 3 134,948,064 (GRCm39) missense probably damaging 0.99
R5281:Cenpe UTSW 3 134,935,911 (GRCm39) missense possibly damaging 0.89
R5389:Cenpe UTSW 3 134,965,149 (GRCm39) critical splice donor site probably null
R5517:Cenpe UTSW 3 134,929,026 (GRCm39) missense probably damaging 1.00
R5521:Cenpe UTSW 3 134,974,826 (GRCm39) missense probably damaging 1.00
R5607:Cenpe UTSW 3 134,940,837 (GRCm39) nonsense probably null
R5608:Cenpe UTSW 3 134,940,837 (GRCm39) nonsense probably null
R5627:Cenpe UTSW 3 134,941,234 (GRCm39) missense possibly damaging 0.51
R5766:Cenpe UTSW 3 134,954,174 (GRCm39) missense probably damaging 0.96
R5783:Cenpe UTSW 3 134,967,341 (GRCm39) missense probably benign 0.00
R5933:Cenpe UTSW 3 134,967,389 (GRCm39) missense probably benign 0.03
R6073:Cenpe UTSW 3 134,965,834 (GRCm39) nonsense probably null
R6163:Cenpe UTSW 3 134,974,764 (GRCm39) missense probably damaging 0.99
R6192:Cenpe UTSW 3 134,954,291 (GRCm39) missense possibly damaging 0.93
R6224:Cenpe UTSW 3 134,949,536 (GRCm39) missense possibly damaging 0.87
R6313:Cenpe UTSW 3 134,935,936 (GRCm39) missense probably benign 0.26
R6326:Cenpe UTSW 3 134,945,539 (GRCm39) missense probably benign 0.15
R6383:Cenpe UTSW 3 134,957,289 (GRCm39) missense probably damaging 1.00
R6418:Cenpe UTSW 3 134,957,305 (GRCm39) missense probably damaging 0.99
R6797:Cenpe UTSW 3 134,943,899 (GRCm39) missense possibly damaging 0.92
R6810:Cenpe UTSW 3 134,949,583 (GRCm39) missense probably benign 0.00
R6989:Cenpe UTSW 3 134,940,888 (GRCm39) missense probably damaging 1.00
R7009:Cenpe UTSW 3 134,940,963 (GRCm39) missense probably benign 0.02
R7009:Cenpe UTSW 3 134,940,962 (GRCm39) missense probably damaging 0.97
R7039:Cenpe UTSW 3 134,961,217 (GRCm39) missense probably benign 0.28
R7387:Cenpe UTSW 3 134,952,798 (GRCm39) missense probably benign 0.05
R7470:Cenpe UTSW 3 134,947,916 (GRCm39) missense probably damaging 1.00
R7535:Cenpe UTSW 3 134,949,523 (GRCm39) missense possibly damaging 0.90
R7562:Cenpe UTSW 3 134,954,395 (GRCm39) missense probably damaging 1.00
R7573:Cenpe UTSW 3 134,953,220 (GRCm39) missense probably damaging 1.00
R7613:Cenpe UTSW 3 134,948,063 (GRCm39) missense possibly damaging 0.90
R7741:Cenpe UTSW 3 134,953,096 (GRCm39) splice site probably null
R7771:Cenpe UTSW 3 134,946,702 (GRCm39) splice site probably null
R7843:Cenpe UTSW 3 134,938,720 (GRCm39) nonsense probably null
R7973:Cenpe UTSW 3 134,929,011 (GRCm39) missense probably damaging 1.00
R8036:Cenpe UTSW 3 134,945,609 (GRCm39) frame shift probably null
R8069:Cenpe UTSW 3 134,949,479 (GRCm39) missense probably damaging 1.00
R8151:Cenpe UTSW 3 134,952,783 (GRCm39) missense probably benign 0.28
R8176:Cenpe UTSW 3 134,935,851 (GRCm39) missense probably damaging 1.00
R8191:Cenpe UTSW 3 134,957,375 (GRCm39) missense probably benign
R8251:Cenpe UTSW 3 134,957,445 (GRCm39) critical splice donor site probably null
R8425:Cenpe UTSW 3 134,948,388 (GRCm39) nonsense probably null
R8488:Cenpe UTSW 3 134,965,002 (GRCm39) missense probably damaging 1.00
R8811:Cenpe UTSW 3 134,929,001 (GRCm39) missense probably damaging 1.00
R8850:Cenpe UTSW 3 134,930,777 (GRCm39) missense probably damaging 1.00
R8899:Cenpe UTSW 3 134,945,644 (GRCm39) missense probably benign 0.18
R9035:Cenpe UTSW 3 134,976,572 (GRCm39) missense probably benign 0.01
R9038:Cenpe UTSW 3 134,923,797 (GRCm39) missense probably benign 0.00
R9093:Cenpe UTSW 3 134,945,641 (GRCm39) nonsense probably null
R9221:Cenpe UTSW 3 134,935,839 (GRCm39) missense possibly damaging 0.90
R9365:Cenpe UTSW 3 134,954,207 (GRCm39) missense possibly damaging 0.56
R9443:Cenpe UTSW 3 134,976,609 (GRCm39) missense probably damaging 0.99
Z1177:Cenpe UTSW 3 134,922,146 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AGTCCAGTAGGTATTTCTCCCC -3'
(R):5'- AACTTTTCAGAGAGCACCTACATAC -3'

Sequencing Primer
(F):5'- AGTAGGTATTTCTCCCCCTTAGAATG -3'
(R):5'- GAGAGCACCTACATACAAACTACAG -3'
Posted On 2021-07-15