Incidental Mutation 'R8879:Dhcr24'
ID 676750
Institutional Source Beutler Lab
Gene Symbol Dhcr24
Ensembl Gene ENSMUSG00000034926
Gene Name 24-dehydrocholesterol reductase
Synonyms 2310076D10Rik, seladin-1, 5830417J06Rik, 3-beta-hydroxysterol delta-24 reductase
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.854) question?
Stock # R8879 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 106561038-106589113 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 106573809 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 232 (I232V)
Ref Sequence ENSEMBL: ENSMUSP00000038063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047973]
AlphaFold Q8VCH6
Predicted Effect probably benign
Transcript: ENSMUST00000047973
AA Change: I232V

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000038063
Gene: ENSMUSG00000034926
AA Change: I232V

DomainStartEndE-ValueType
Pfam:FAD_binding_4 71 203 2e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a flavin adenine dinucleotide (FAD)-dependent oxidoreductase which catalyzes the reduction of the delta-24 double bond of sterol intermediates during cholesterol biosynthesis. The protein contains a leader sequence that directs it to the endoplasmic reticulum membrane. Missense mutations in this gene have been associated with desmosterolosis. Also, reduced expression of the gene occurs in the temporal cortex of Alzheimer disease patients and overexpression has been observed in adrenal gland cancer cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: In spite of having almost no plasma or tissue cholesterol, homozygous mutant mice are largely viable and display a mild growth phenotype. Inactivation did impair prenatal viability as well as infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C T 15: 58,022,509 V326M probably damaging Het
Adap2 T A 11: 80,156,959 H80Q probably benign Het
Ang4 T C 14: 51,764,486 T2A probably benign Het
Arf2 T C 11: 103,979,759 probably null Het
B3gnt4 A G 5: 123,511,148 D192G probably damaging Het
BC034090 T C 1: 155,226,357 I54V probably benign Het
Catsper3 A G 13: 55,804,895 T202A probably benign Het
Cenpe T A 3: 135,260,101 D2113E probably damaging Het
Clasp2 T C 9: 113,773,705 V191A probably benign Het
Col5a1 G T 2: 28,014,158 A1356S unknown Het
Cuzd1 A G 7: 131,308,848 S573P probably damaging Het
Cyp1a2 C A 9: 57,681,885 M215I possibly damaging Het
Dcaf17 T A 2: 71,063,402 I122K possibly damaging Het
Dnah10 A G 5: 124,818,117 E3570G probably damaging Het
Dnaja4 A T 9: 54,714,704 probably benign Het
Ehd1 A G 19: 6,298,324 D444G probably damaging Het
Ehmt1 T A 2: 24,836,476 M766L possibly damaging Het
Eno4 A G 19: 58,970,722 I613M probably benign Het
Exoc3l A T 8: 105,290,549 M602K Het
Fam107a C T 14: 8,301,352 probably null Het
Frem3 A T 8: 80,613,148 D690V probably damaging Het
Gm11639 T C 11: 104,690,955 I41T probably benign Het
Gm19410 A T 8: 35,771,868 D97V probably damaging Het
Grik5 T A 7: 25,023,064 D540V possibly damaging Het
Hint1 T A 11: 54,869,943 D69E probably benign Het
Krt13 T C 11: 100,119,385 T257A probably benign Het
Lpin2 T C 17: 71,242,754 L676P probably damaging Het
Lrguk A G 6: 34,029,683 E76G probably benign Het
Lrrc8a A G 2: 30,256,298 M375V probably benign Het
Lrrtm3 T C 10: 64,089,238 Q50R possibly damaging Het
Mmrn1 T A 6: 60,976,529 L598Q probably damaging Het
Mrs2 A G 13: 25,001,784 I135T probably damaging Het
Neb T C 2: 52,235,580 D475G Het
Notch2 A G 3: 98,135,599 S1427G possibly damaging Het
Olfr118 C A 17: 37,672,411 Y129* probably null Het
Olfr682-ps1 A G 7: 105,126,686 V195A probably benign Het
Olfr694 A T 7: 106,689,089 I214N probably damaging Het
Olfr816 A G 10: 129,911,862 C139R probably damaging Het
Olfr952 A C 9: 39,426,219 V284G possibly damaging Het
Opcml T C 9: 28,902,151 F246S probably damaging Het
Pdzd2 C A 15: 12,402,319 V729F probably damaging Het
Pias2 C T 18: 77,146,768 Q565* probably null Het
Pnp T A 14: 50,950,720 probably null Het
Ptpn18 T C 1: 34,463,130 S76P probably benign Het
Qtrt2 A T 16: 43,863,197 L304Q probably damaging Het
Rad51ap2 A T 12: 11,457,400 E441V possibly damaging Het
Ranbp2 T A 10: 58,477,889 V1477E probably benign Het
Repin1 C T 6: 48,597,433 T432I possibly damaging Het
Rest G A 5: 77,282,511 G926R probably benign Het
Rnft1 T A 11: 86,486,690 F143L possibly damaging Het
Sema3e A T 5: 14,232,094 I415L probably benign Het
Slc10a1 T A 12: 80,967,595 N117I probably damaging Het
Slc25a23 G A 17: 57,059,709 probably benign Het
Slc2a2 T C 3: 28,713,802 S160P possibly damaging Het
Srrd A G 5: 112,338,456 V178A possibly damaging Het
Tmigd3 G T 3: 105,921,961 G198C probably benign Het
Trbv29 G A 6: 41,271,405 M1I probably null Het
Tril A G 6: 53,819,584 S218P probably damaging Het
Trip11 T C 12: 101,862,598 K1749R probably benign Het
Ttc25 G T 11: 100,566,926 E452* probably null Het
Ttn A G 2: 76,830,651 V12011A Het
Ubr4 T G 4: 139,410,518 F1093V probably benign Het
Urb2 C A 8: 124,028,403 A283E probably benign Het
Usp43 T A 11: 67,898,881 probably benign Het
Vmn1r28 A T 6: 58,265,684 I171F probably benign Het
Vps33a G A 5: 123,533,899 R469W probably damaging Het
Zfp202 G A 9: 40,211,757 R605Q probably damaging Het
Zpbp2 A T 11: 98,554,620 H158L probably benign Het
Other mutations in Dhcr24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Dhcr24 APN 4 106572278 missense possibly damaging 0.50
IGL01548:Dhcr24 APN 4 106573871 nonsense probably null
IGL02110:Dhcr24 APN 4 106573801 missense probably damaging 1.00
IGL02256:Dhcr24 APN 4 106572320 missense probably damaging 0.98
IGL02748:Dhcr24 APN 4 106564392 splice site probably benign
IGL02926:Dhcr24 APN 4 106586355 missense probably damaging 0.98
ANU22:Dhcr24 UTSW 4 106572278 missense possibly damaging 0.50
R0423:Dhcr24 UTSW 4 106586536 unclassified probably benign
R1632:Dhcr24 UTSW 4 106585951 missense probably benign
R1771:Dhcr24 UTSW 4 106578253 missense probably benign 0.00
R2138:Dhcr24 UTSW 4 106572302 nonsense probably null
R2139:Dhcr24 UTSW 4 106572302 nonsense probably null
R2420:Dhcr24 UTSW 4 106561094 start gained probably benign
R2422:Dhcr24 UTSW 4 106561094 start gained probably benign
R2570:Dhcr24 UTSW 4 106585832 missense probably benign 0.00
R3176:Dhcr24 UTSW 4 106561239 missense probably benign 0.16
R3276:Dhcr24 UTSW 4 106561239 missense probably benign 0.16
R3842:Dhcr24 UTSW 4 106585805 missense probably damaging 1.00
R3852:Dhcr24 UTSW 4 106573873 missense probably benign 0.02
R4037:Dhcr24 UTSW 4 106573878 missense probably benign 0.01
R4038:Dhcr24 UTSW 4 106573878 missense probably benign 0.01
R4039:Dhcr24 UTSW 4 106573878 missense probably benign 0.01
R5831:Dhcr24 UTSW 4 106564414 missense probably benign 0.03
R7285:Dhcr24 UTSW 4 106571519 critical splice donor site probably null
R7821:Dhcr24 UTSW 4 106571436 missense possibly damaging 0.61
R8012:Dhcr24 UTSW 4 106586656 missense probably damaging 1.00
X0057:Dhcr24 UTSW 4 106586345 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTCTGAAACAGGGAGCAGTAG -3'
(R):5'- CCATGCCACATGAAGCAGTC -3'

Sequencing Primer
(F):5'- TTAAAGTCACGTGAAGCAGAAATTG -3'
(R):5'- GCAGTCTAAATAGGCCCAGTGC -3'
Posted On 2021-07-15