Mutagenetix > Incidental Mutation

Incidental Mutation 'R8879:Sema3e'

676752

Institutional Source

Beutler Lab

Gene Symbol

Sema3e

Ensembl Gene

ENSMUSG00000063531

Gene Name

sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E

Synonyms

Semah

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.549) question?

Stock #

R8879 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

14025276-14256689 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 14232094 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 415 (I415L)

Ref Sequence

ENSEMBL: ENSMUSP00000073612 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073957]

AlphaFold

P70275

Predicted Effect

probably benign
Transcript: ENSMUST00000073957
AA Change: I415L

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000073612
Gene: ENSMUSG00000063531
AA Change: I415L

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Sema	58	500	1.85e-194	SMART
PSI	518	573	1.81e-10	SMART
IG	587	673	5.75e-4	SMART
low complexity region	737	750	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Semaphorins are a large family of conserved secreted and membrane associated proteins which possess a semaphorin (Sema) domain and a PSI domain (found in plexins, semaphorins and integrins) in the N-terminal extracellular portion. Based on sequence and structural similarities, semaphorins are put into eight classes: invertebrates contain classes 1 and 2, viruses have class V, and vertebrates contain classes 3-7. Semaphorins serve as axon guidance ligands via multimeric receptor complexes, some (if not all) containing plexin proteins. This gene encodes a class 4 semaphorin. This gene encodes a class 3 semaphorin. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display abnormal intersomitic vacular development and loss of the normal segmented somite pattern. Homozygous mutants for another allele have Bergmeister papillae on the surface of the optic disc. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130401M01Rik	C	T	15: 58,022,509	V326M	probably damaging	Het
Adap2	T	A	11: 80,156,959	H80Q	probably benign	Het
Ang4	T	C	14: 51,764,486	T2A	probably benign	Het
Arf2	T	C	11: 103,979,759		probably null	Het
B3gnt4	A	G	5: 123,511,148	D192G	probably damaging	Het
BC034090	T	C	1: 155,226,357	I54V	probably benign	Het
Catsper3	A	G	13: 55,804,895	T202A	probably benign	Het
Cenpe	T	A	3: 135,260,101	D2113E	probably damaging	Het
Clasp2	T	C	9: 113,773,705	V191A	probably benign	Het
Col5a1	G	T	2: 28,014,158	A1356S	unknown	Het
Cuzd1	A	G	7: 131,308,848	S573P	probably damaging	Het
Cyp1a2	C	A	9: 57,681,885	M215I	possibly damaging	Het
Dcaf17	T	A	2: 71,063,402	I122K	possibly damaging	Het
Dhcr24	A	G	4: 106,573,809	I232V	probably benign	Het
Dnah10	A	G	5: 124,818,117	E3570G	probably damaging	Het
Dnaja4	A	T	9: 54,714,704		probably benign	Het
Ehd1	A	G	19: 6,298,324	D444G	probably damaging	Het
Ehmt1	T	A	2: 24,836,476	M766L	possibly damaging	Het
Eno4	A	G	19: 58,970,722	I613M	probably benign	Het
Exoc3l	A	T	8: 105,290,549	M602K		Het
Fam107a	C	T	14: 8,301,352		probably null	Het
Frem3	A	T	8: 80,613,148	D690V	probably damaging	Het
Gm11639	T	C	11: 104,690,955	I41T	probably benign	Het
Gm19410	A	T	8: 35,771,868	D97V	probably damaging	Het
Grik5	T	A	7: 25,023,064	D540V	possibly damaging	Het
Hint1	T	A	11: 54,869,943	D69E	probably benign	Het
Krt13	T	C	11: 100,119,385	T257A	probably benign	Het
Lpin2	T	C	17: 71,242,754	L676P	probably damaging	Het
Lrguk	A	G	6: 34,029,683	E76G	probably benign	Het
Lrrc8a	A	G	2: 30,256,298	M375V	probably benign	Het
Lrrtm3	T	C	10: 64,089,238	Q50R	possibly damaging	Het
Mmrn1	T	A	6: 60,976,529	L598Q	probably damaging	Het
Mrs2	A	G	13: 25,001,784	I135T	probably damaging	Het
Neb	T	C	2: 52,235,580	D475G		Het
Notch2	A	G	3: 98,135,599	S1427G	possibly damaging	Het
Olfr118	C	A	17: 37,672,411	Y129*	probably null	Het
Olfr682-ps1	A	G	7: 105,126,686	V195A	probably benign	Het
Olfr694	A	T	7: 106,689,089	I214N	probably damaging	Het
Olfr816	A	G	10: 129,911,862	C139R	probably damaging	Het
Olfr952	A	C	9: 39,426,219	V284G	possibly damaging	Het
Opcml	T	C	9: 28,902,151	F246S	probably damaging	Het
Pdzd2	C	A	15: 12,402,319	V729F	probably damaging	Het
Pias2	C	T	18: 77,146,768	Q565*	probably null	Het
Pnp	T	A	14: 50,950,720		probably null	Het
Ptpn18	T	C	1: 34,463,130	S76P	probably benign	Het
Qtrt2	A	T	16: 43,863,197	L304Q	probably damaging	Het
Rad51ap2	A	T	12: 11,457,400	E441V	possibly damaging	Het
Ranbp2	T	A	10: 58,477,889	V1477E	probably benign	Het
Repin1	C	T	6: 48,597,433	T432I	possibly damaging	Het
Rest	G	A	5: 77,282,511	G926R	probably benign	Het
Rnft1	T	A	11: 86,486,690	F143L	possibly damaging	Het
Slc10a1	T	A	12: 80,967,595	N117I	probably damaging	Het
Slc25a23	G	A	17: 57,059,709		probably benign	Het
Slc2a2	T	C	3: 28,713,802	S160P	possibly damaging	Het
Srrd	A	G	5: 112,338,456	V178A	possibly damaging	Het
Tmigd3	G	T	3: 105,921,961	G198C	probably benign	Het
Trbv29	G	A	6: 41,271,405	M1I	probably null	Het
Tril	A	G	6: 53,819,584	S218P	probably damaging	Het
Trip11	T	C	12: 101,862,598	K1749R	probably benign	Het
Ttc25	G	T	11: 100,566,926	E452*	probably null	Het
Ttn	A	G	2: 76,830,651	V12011A		Het
Ubr4	T	G	4: 139,410,518	F1093V	probably benign	Het
Urb2	C	A	8: 124,028,403	A283E	probably benign	Het
Usp43	T	A	11: 67,898,881		probably benign	Het
Vmn1r28	A	T	6: 58,265,684	I171F	probably benign	Het
Vps33a	G	A	5: 123,533,899	R469W	probably damaging	Het
Zfp202	G	A	9: 40,211,757	R605Q	probably damaging	Het
Zpbp2	A	T	11: 98,554,620	H158L	probably benign	Het

Other mutations in Sema3e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Sema3e	APN	5	14240572	missense	probably damaging	1.00
IGL01068:Sema3e	APN	5	14233718	critical splice donor site	probably null
IGL01128:Sema3e	APN	5	14232115	missense	probably damaging	1.00
IGL01134:Sema3e	APN	5	14252770	missense	probably damaging	1.00
IGL02013:Sema3e	APN	5	14230193	missense	probably damaging	1.00
IGL02051:Sema3e	APN	5	14224310	missense	possibly damaging	0.77
IGL02309:Sema3e	APN	5	14224390	missense	probably damaging	0.98
IGL02636:Sema3e	APN	5	14225656	missense	probably benign
IGL02702:Sema3e	APN	5	14233726	splice site	probably benign
IGL03001:Sema3e	APN	5	14241043	missense	probably benign	0.19
R0011:Sema3e	UTSW	5	14144011	nonsense	probably null
R0098:Sema3e	UTSW	5	14252432	missense	possibly damaging	0.52
R0098:Sema3e	UTSW	5	14252432	missense	possibly damaging	0.52
R0220:Sema3e	UTSW	5	14164153	missense	possibly damaging	0.56
R0564:Sema3e	UTSW	5	14236085	critical splice donor site	probably null
R1079:Sema3e	UTSW	5	14225655	missense	probably benign	0.12
R1187:Sema3e	UTSW	5	14232084	missense	probably damaging	1.00
R1670:Sema3e	UTSW	5	14162185	splice site	probably benign
R1736:Sema3e	UTSW	5	14210376	missense	probably damaging	1.00
R3433:Sema3e	UTSW	5	14252714	missense	probably benign	0.00
R3831:Sema3e	UTSW	5	14226482	missense	probably damaging	1.00
R4094:Sema3e	UTSW	5	14233690	missense	probably benign	0.12
R4580:Sema3e	UTSW	5	14233703	missense	probably damaging	1.00
R4828:Sema3e	UTSW	5	14226640	missense	probably damaging	1.00
R4855:Sema3e	UTSW	5	14230130	missense	probably damaging	0.99
R4884:Sema3e	UTSW	5	14225565	missense	probably damaging	1.00
R4960:Sema3e	UTSW	5	14252632	missense	possibly damaging	0.93
R5264:Sema3e	UTSW	5	14226648	missense	probably damaging	1.00
R5389:Sema3e	UTSW	5	14236085	critical splice donor site	probably benign
R5512:Sema3e	UTSW	5	14230180	missense	probably damaging	1.00
R5642:Sema3e	UTSW	5	14162243	missense	probably damaging	1.00
R5647:Sema3e	UTSW	5	14225553	missense	probably damaging	0.99
R5814:Sema3e	UTSW	5	14225666	missense	probably benign	0.01
R5993:Sema3e	UTSW	5	14224293	missense	probably damaging	1.00
R6076:Sema3e	UTSW	5	14241086	missense	probably benign	0.01
R6906:Sema3e	UTSW	5	14240587	missense	probably damaging	1.00
R7432:Sema3e	UTSW	5	14224390	missense	probably damaging	0.98
R8738:Sema3e	UTSW	5	14164155	missense	possibly damaging	0.95
R8849:Sema3e	UTSW	5	14252659	missense	probably damaging	1.00
R8935:Sema3e	UTSW	5	14232113	missense	probably damaging	0.97
R9071:Sema3e	UTSW	5	14232140	missense	probably benign	0.00
R9100:Sema3e	UTSW	5	14232194	missense	probably damaging	1.00
R9367:Sema3e	UTSW	5	14241070	missense	probably benign	0.00
R9444:Sema3e	UTSW	5	14252611	missense	possibly damaging	0.63
R9478:Sema3e	UTSW	5	14236372	missense	probably damaging	1.00
R9601:Sema3e	UTSW	5	14252383	missense	possibly damaging	0.95
R9671:Sema3e	UTSW	5	14162203	missense	probably benign	0.00
X0064:Sema3e	UTSW	5	14230142	missense	probably benign	0.05
Z1088:Sema3e	UTSW	5	14226456	missense	probably damaging	0.97
Z1177:Sema3e	UTSW	5	14025711	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- ACATGTTTGCTTTTGGATGTAAGAG -3'
(R):5'- ACAACATGTGACGATTAGTACACAT -3'

Sequencing Primer
(F):5'- TGCTTTTGGATGTAAGAGAAACAGC -3'
(R):5'- GCAGCTCTAAGGCATGCGAATC -3'

Posted On

2021-07-15