Incidental Mutation 'R8879:Sema3e'
ID 676752
Institutional Source Beutler Lab
Gene Symbol Sema3e
Ensembl Gene ENSMUSG00000063531
Gene Name sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E
Synonyms Semah
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.549) question?
Stock # R8879 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 14025276-14256689 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 14232094 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 415 (I415L)
Ref Sequence ENSEMBL: ENSMUSP00000073612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073957]
AlphaFold P70275
Predicted Effect probably benign
Transcript: ENSMUST00000073957
AA Change: I415L

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000073612
Gene: ENSMUSG00000063531
AA Change: I415L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 58 500 1.85e-194 SMART
PSI 518 573 1.81e-10 SMART
IG 587 673 5.75e-4 SMART
low complexity region 737 750 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Semaphorins are a large family of conserved secreted and membrane associated proteins which possess a semaphorin (Sema) domain and a PSI domain (found in plexins, semaphorins and integrins) in the N-terminal extracellular portion. Based on sequence and structural similarities, semaphorins are put into eight classes: invertebrates contain classes 1 and 2, viruses have class V, and vertebrates contain classes 3-7. Semaphorins serve as axon guidance ligands via multimeric receptor complexes, some (if not all) containing plexin proteins. This gene encodes a class 4 semaphorin. This gene encodes a class 3 semaphorin. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display abnormal intersomitic vacular development and loss of the normal segmented somite pattern. Homozygous mutants for another allele have Bergmeister papillae on the surface of the optic disc. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C T 15: 58,022,509 V326M probably damaging Het
Adap2 T A 11: 80,156,959 H80Q probably benign Het
Ang4 T C 14: 51,764,486 T2A probably benign Het
Arf2 T C 11: 103,979,759 probably null Het
B3gnt4 A G 5: 123,511,148 D192G probably damaging Het
BC034090 T C 1: 155,226,357 I54V probably benign Het
Catsper3 A G 13: 55,804,895 T202A probably benign Het
Cenpe T A 3: 135,260,101 D2113E probably damaging Het
Clasp2 T C 9: 113,773,705 V191A probably benign Het
Col5a1 G T 2: 28,014,158 A1356S unknown Het
Cuzd1 A G 7: 131,308,848 S573P probably damaging Het
Cyp1a2 C A 9: 57,681,885 M215I possibly damaging Het
Dcaf17 T A 2: 71,063,402 I122K possibly damaging Het
Dhcr24 A G 4: 106,573,809 I232V probably benign Het
Dnah10 A G 5: 124,818,117 E3570G probably damaging Het
Dnaja4 A T 9: 54,714,704 probably benign Het
Ehd1 A G 19: 6,298,324 D444G probably damaging Het
Ehmt1 T A 2: 24,836,476 M766L possibly damaging Het
Eno4 A G 19: 58,970,722 I613M probably benign Het
Exoc3l A T 8: 105,290,549 M602K Het
Fam107a C T 14: 8,301,352 probably null Het
Frem3 A T 8: 80,613,148 D690V probably damaging Het
Gm11639 T C 11: 104,690,955 I41T probably benign Het
Gm19410 A T 8: 35,771,868 D97V probably damaging Het
Grik5 T A 7: 25,023,064 D540V possibly damaging Het
Hint1 T A 11: 54,869,943 D69E probably benign Het
Krt13 T C 11: 100,119,385 T257A probably benign Het
Lpin2 T C 17: 71,242,754 L676P probably damaging Het
Lrguk A G 6: 34,029,683 E76G probably benign Het
Lrrc8a A G 2: 30,256,298 M375V probably benign Het
Lrrtm3 T C 10: 64,089,238 Q50R possibly damaging Het
Mmrn1 T A 6: 60,976,529 L598Q probably damaging Het
Mrs2 A G 13: 25,001,784 I135T probably damaging Het
Neb T C 2: 52,235,580 D475G Het
Notch2 A G 3: 98,135,599 S1427G possibly damaging Het
Olfr118 C A 17: 37,672,411 Y129* probably null Het
Olfr682-ps1 A G 7: 105,126,686 V195A probably benign Het
Olfr694 A T 7: 106,689,089 I214N probably damaging Het
Olfr816 A G 10: 129,911,862 C139R probably damaging Het
Olfr952 A C 9: 39,426,219 V284G possibly damaging Het
Opcml T C 9: 28,902,151 F246S probably damaging Het
Pdzd2 C A 15: 12,402,319 V729F probably damaging Het
Pias2 C T 18: 77,146,768 Q565* probably null Het
Pnp T A 14: 50,950,720 probably null Het
Ptpn18 T C 1: 34,463,130 S76P probably benign Het
Qtrt2 A T 16: 43,863,197 L304Q probably damaging Het
Rad51ap2 A T 12: 11,457,400 E441V possibly damaging Het
Ranbp2 T A 10: 58,477,889 V1477E probably benign Het
Repin1 C T 6: 48,597,433 T432I possibly damaging Het
Rest G A 5: 77,282,511 G926R probably benign Het
Rnft1 T A 11: 86,486,690 F143L possibly damaging Het
Slc10a1 T A 12: 80,967,595 N117I probably damaging Het
Slc25a23 G A 17: 57,059,709 probably benign Het
Slc2a2 T C 3: 28,713,802 S160P possibly damaging Het
Srrd A G 5: 112,338,456 V178A possibly damaging Het
Tmigd3 G T 3: 105,921,961 G198C probably benign Het
Trbv29 G A 6: 41,271,405 M1I probably null Het
Tril A G 6: 53,819,584 S218P probably damaging Het
Trip11 T C 12: 101,862,598 K1749R probably benign Het
Ttc25 G T 11: 100,566,926 E452* probably null Het
Ttn A G 2: 76,830,651 V12011A Het
Ubr4 T G 4: 139,410,518 F1093V probably benign Het
Urb2 C A 8: 124,028,403 A283E probably benign Het
Usp43 T A 11: 67,898,881 probably benign Het
Vmn1r28 A T 6: 58,265,684 I171F probably benign Het
Vps33a G A 5: 123,533,899 R469W probably damaging Het
Zfp202 G A 9: 40,211,757 R605Q probably damaging Het
Zpbp2 A T 11: 98,554,620 H158L probably benign Het
Other mutations in Sema3e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Sema3e APN 5 14240572 missense probably damaging 1.00
IGL01068:Sema3e APN 5 14233718 critical splice donor site probably null
IGL01128:Sema3e APN 5 14232115 missense probably damaging 1.00
IGL01134:Sema3e APN 5 14252770 missense probably damaging 1.00
IGL02013:Sema3e APN 5 14230193 missense probably damaging 1.00
IGL02051:Sema3e APN 5 14224310 missense possibly damaging 0.77
IGL02309:Sema3e APN 5 14224390 missense probably damaging 0.98
IGL02636:Sema3e APN 5 14225656 missense probably benign
IGL02702:Sema3e APN 5 14233726 splice site probably benign
IGL03001:Sema3e APN 5 14241043 missense probably benign 0.19
R0011:Sema3e UTSW 5 14144011 nonsense probably null
R0098:Sema3e UTSW 5 14252432 missense possibly damaging 0.52
R0098:Sema3e UTSW 5 14252432 missense possibly damaging 0.52
R0220:Sema3e UTSW 5 14164153 missense possibly damaging 0.56
R0564:Sema3e UTSW 5 14236085 critical splice donor site probably null
R1079:Sema3e UTSW 5 14225655 missense probably benign 0.12
R1187:Sema3e UTSW 5 14232084 missense probably damaging 1.00
R1670:Sema3e UTSW 5 14162185 splice site probably benign
R1736:Sema3e UTSW 5 14210376 missense probably damaging 1.00
R3433:Sema3e UTSW 5 14252714 missense probably benign 0.00
R3831:Sema3e UTSW 5 14226482 missense probably damaging 1.00
R4094:Sema3e UTSW 5 14233690 missense probably benign 0.12
R4580:Sema3e UTSW 5 14233703 missense probably damaging 1.00
R4828:Sema3e UTSW 5 14226640 missense probably damaging 1.00
R4855:Sema3e UTSW 5 14230130 missense probably damaging 0.99
R4884:Sema3e UTSW 5 14225565 missense probably damaging 1.00
R4960:Sema3e UTSW 5 14252632 missense possibly damaging 0.93
R5264:Sema3e UTSW 5 14226648 missense probably damaging 1.00
R5389:Sema3e UTSW 5 14236085 critical splice donor site probably benign
R5512:Sema3e UTSW 5 14230180 missense probably damaging 1.00
R5642:Sema3e UTSW 5 14162243 missense probably damaging 1.00
R5647:Sema3e UTSW 5 14225553 missense probably damaging 0.99
R5814:Sema3e UTSW 5 14225666 missense probably benign 0.01
R5993:Sema3e UTSW 5 14224293 missense probably damaging 1.00
R6076:Sema3e UTSW 5 14241086 missense probably benign 0.01
R6906:Sema3e UTSW 5 14240587 missense probably damaging 1.00
R7432:Sema3e UTSW 5 14224390 missense probably damaging 0.98
R8738:Sema3e UTSW 5 14164155 missense possibly damaging 0.95
R8849:Sema3e UTSW 5 14252659 missense probably damaging 1.00
R8935:Sema3e UTSW 5 14232113 missense probably damaging 0.97
R9071:Sema3e UTSW 5 14232140 missense probably benign 0.00
R9100:Sema3e UTSW 5 14232194 missense probably damaging 1.00
R9367:Sema3e UTSW 5 14241070 missense probably benign 0.00
R9444:Sema3e UTSW 5 14252611 missense possibly damaging 0.63
R9478:Sema3e UTSW 5 14236372 missense probably damaging 1.00
R9601:Sema3e UTSW 5 14252383 missense possibly damaging 0.95
R9671:Sema3e UTSW 5 14162203 missense probably benign 0.00
X0064:Sema3e UTSW 5 14230142 missense probably benign 0.05
Z1088:Sema3e UTSW 5 14226456 missense probably damaging 0.97
Z1177:Sema3e UTSW 5 14025711 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACATGTTTGCTTTTGGATGTAAGAG -3'
(R):5'- ACAACATGTGACGATTAGTACACAT -3'

Sequencing Primer
(F):5'- TGCTTTTGGATGTAAGAGAAACAGC -3'
(R):5'- GCAGCTCTAAGGCATGCGAATC -3'
Posted On 2021-07-15