Incidental Mutation 'R8879:Srrd'
ID 676754
Institutional Source Beutler Lab
Gene Symbol Srrd
Ensembl Gene ENSMUSG00000029346
Gene Name SRR1 domain containing
Synonyms Srr1, 2810002G02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.638) question?
Stock # R8879 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 112337392-112343040 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 112338456 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 178 (V178A)
Ref Sequence ENSEMBL: ENSMUSP00000031289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031288] [ENSMUST00000031289] [ENSMUST00000035279] [ENSMUST00000112359] [ENSMUST00000146510]
AlphaFold Q8K2M3
Predicted Effect probably benign
Transcript: ENSMUST00000031288
SMART Domains Protein: ENSMUSP00000031288
Gene: ENSMUSG00000029345

DomainStartEndE-ValueType
Pfam:TIP_N 17 114 1.4e-30 PFAM
G_patch 148 194 3.3e-18 SMART
low complexity region 212 218 N/A INTRINSIC
low complexity region 228 242 N/A INTRINSIC
Pfam:GCFC 398 667 3.4e-102 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000031289
AA Change: V178A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031289
Gene: ENSMUSG00000029346
AA Change: V178A

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
Pfam:SRR1 109 164 2.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000035279
SMART Domains Protein: ENSMUSP00000047920
Gene: ENSMUSG00000042328

DomainStartEndE-ValueType
low complexity region 171 180 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
low complexity region 514 529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112359
SMART Domains Protein: ENSMUSP00000107978
Gene: ENSMUSG00000042328

DomainStartEndE-ValueType
low complexity region 171 180 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
low complexity region 514 529 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000146510
AA Change: V177A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119870
Gene: ENSMUSG00000029346
AA Change: V177A

DomainStartEndE-ValueType
low complexity region 12 53 N/A INTRINSIC
Pfam:SRR1 109 162 1.8e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C T 15: 58,022,509 V326M probably damaging Het
Adap2 T A 11: 80,156,959 H80Q probably benign Het
Ang4 T C 14: 51,764,486 T2A probably benign Het
Arf2 T C 11: 103,979,759 probably null Het
B3gnt4 A G 5: 123,511,148 D192G probably damaging Het
BC034090 T C 1: 155,226,357 I54V probably benign Het
Catsper3 A G 13: 55,804,895 T202A probably benign Het
Cenpe T A 3: 135,260,101 D2113E probably damaging Het
Clasp2 T C 9: 113,773,705 V191A probably benign Het
Col5a1 G T 2: 28,014,158 A1356S unknown Het
Cuzd1 A G 7: 131,308,848 S573P probably damaging Het
Cyp1a2 C A 9: 57,681,885 M215I possibly damaging Het
Dcaf17 T A 2: 71,063,402 I122K possibly damaging Het
Dhcr24 A G 4: 106,573,809 I232V probably benign Het
Dnah10 A G 5: 124,818,117 E3570G probably damaging Het
Dnaja4 A T 9: 54,714,704 probably benign Het
Ehd1 A G 19: 6,298,324 D444G probably damaging Het
Ehmt1 T A 2: 24,836,476 M766L possibly damaging Het
Eno4 A G 19: 58,970,722 I613M probably benign Het
Exoc3l A T 8: 105,290,549 M602K Het
Fam107a C T 14: 8,301,352 probably null Het
Frem3 A T 8: 80,613,148 D690V probably damaging Het
Gm11639 T C 11: 104,690,955 I41T probably benign Het
Gm19410 A T 8: 35,771,868 D97V probably damaging Het
Grik5 T A 7: 25,023,064 D540V possibly damaging Het
Hint1 T A 11: 54,869,943 D69E probably benign Het
Krt13 T C 11: 100,119,385 T257A probably benign Het
Lpin2 T C 17: 71,242,754 L676P probably damaging Het
Lrguk A G 6: 34,029,683 E76G probably benign Het
Lrrc8a A G 2: 30,256,298 M375V probably benign Het
Lrrtm3 T C 10: 64,089,238 Q50R possibly damaging Het
Mmrn1 T A 6: 60,976,529 L598Q probably damaging Het
Mrs2 A G 13: 25,001,784 I135T probably damaging Het
Neb T C 2: 52,235,580 D475G Het
Notch2 A G 3: 98,135,599 S1427G possibly damaging Het
Olfr118 C A 17: 37,672,411 Y129* probably null Het
Olfr682-ps1 A G 7: 105,126,686 V195A probably benign Het
Olfr694 A T 7: 106,689,089 I214N probably damaging Het
Olfr816 A G 10: 129,911,862 C139R probably damaging Het
Olfr952 A C 9: 39,426,219 V284G possibly damaging Het
Opcml T C 9: 28,902,151 F246S probably damaging Het
Pdzd2 C A 15: 12,402,319 V729F probably damaging Het
Pias2 C T 18: 77,146,768 Q565* probably null Het
Pnp T A 14: 50,950,720 probably null Het
Ptpn18 T C 1: 34,463,130 S76P probably benign Het
Qtrt2 A T 16: 43,863,197 L304Q probably damaging Het
Rad51ap2 A T 12: 11,457,400 E441V possibly damaging Het
Ranbp2 T A 10: 58,477,889 V1477E probably benign Het
Repin1 C T 6: 48,597,433 T432I possibly damaging Het
Rest G A 5: 77,282,511 G926R probably benign Het
Rnft1 T A 11: 86,486,690 F143L possibly damaging Het
Sema3e A T 5: 14,232,094 I415L probably benign Het
Slc10a1 T A 12: 80,967,595 N117I probably damaging Het
Slc25a23 G A 17: 57,059,709 probably benign Het
Slc2a2 T C 3: 28,713,802 S160P possibly damaging Het
Tmigd3 G T 3: 105,921,961 G198C probably benign Het
Trbv29 G A 6: 41,271,405 M1I probably null Het
Tril A G 6: 53,819,584 S218P probably damaging Het
Trip11 T C 12: 101,862,598 K1749R probably benign Het
Ttc25 G T 11: 100,566,926 E452* probably null Het
Ttn A G 2: 76,830,651 V12011A Het
Ubr4 T G 4: 139,410,518 F1093V probably benign Het
Urb2 C A 8: 124,028,403 A283E probably benign Het
Usp43 T A 11: 67,898,881 probably benign Het
Vmn1r28 A T 6: 58,265,684 I171F probably benign Het
Vps33a G A 5: 123,533,899 R469W probably damaging Het
Zfp202 G A 9: 40,211,757 R605Q probably damaging Het
Zpbp2 A T 11: 98,554,620 H158L probably benign Het
Other mutations in Srrd
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0245:Srrd UTSW 5 112337528 utr 3 prime probably benign
R2038:Srrd UTSW 5 112338450 missense probably benign 0.12
R2162:Srrd UTSW 5 112342944 unclassified probably benign
R2172:Srrd UTSW 5 112341122 missense possibly damaging 0.95
R2246:Srrd UTSW 5 112339756 missense probably damaging 1.00
R6343:Srrd UTSW 5 112340000 missense probably benign 0.05
R7226:Srrd UTSW 5 112337456 missense unknown
R8883:Srrd UTSW 5 112339924 missense possibly damaging 0.95
R9105:Srrd UTSW 5 112337599 missense possibly damaging 0.95
R9487:Srrd UTSW 5 112342899 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGTGCTTTAAGCTAGACCCC -3'
(R):5'- CCCAGAATGTAGGACATGGG -3'

Sequencing Primer
(F):5'- TTTACACAGGTCCTCACAGGG -3'
(R):5'- TGGGGACAGTCATCTCACGAAATAC -3'
Posted On 2021-07-15