Incidental Mutation 'R8879:B3gnt4'
ID 676755
Institutional Source Beutler Lab
Gene Symbol B3gnt4
Ensembl Gene ENSMUSG00000029431
Gene Name UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock # R8879 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 123510460-123511882 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 123511148 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 192 (D192G)
Ref Sequence ENSEMBL: ENSMUSP00000031384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031384] [ENSMUST00000094327] [ENSMUST00000111587] [ENSMUST00000121444] [ENSMUST00000125652] [ENSMUST00000139398] [ENSMUST00000145152] [ENSMUST00000196809] [ENSMUST00000197682] [ENSMUST00000200247]
AlphaFold Q1RLK6
Predicted Effect probably damaging
Transcript: ENSMUST00000031384
AA Change: D192G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031384
Gene: ENSMUSG00000029431
AA Change: D192G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Galactosyl_T 106 297 1.3e-43 PFAM
Pfam:Fringe 169 302 2.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094327
SMART Domains Protein: ENSMUSP00000091885
Gene: ENSMUSG00000063409

DomainStartEndE-ValueType
low complexity region 63 80 N/A INTRINSIC
SCOP:d1a9na_ 117 262 3e-16 SMART
low complexity region 389 402 N/A INTRINSIC
low complexity region 537 565 N/A INTRINSIC
low complexity region 614 629 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111587
SMART Domains Protein: ENSMUSP00000107214
Gene: ENSMUSG00000029433

DomainStartEndE-ValueType
Pfam:Smac_DIABLO 9 237 4.1e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121444
SMART Domains Protein: ENSMUSP00000113933
Gene: ENSMUSG00000063409

DomainStartEndE-ValueType
low complexity region 63 80 N/A INTRINSIC
SCOP:d1a9na_ 117 262 4e-16 SMART
low complexity region 389 402 N/A INTRINSIC
low complexity region 530 558 N/A INTRINSIC
low complexity region 607 622 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125652
SMART Domains Protein: ENSMUSP00000115045
Gene: ENSMUSG00000029433

DomainStartEndE-ValueType
Pfam:Smac_DIABLO 6 237 1.1e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139398
SMART Domains Protein: ENSMUSP00000143485
Gene: ENSMUSG00000029433

DomainStartEndE-ValueType
Pfam:Smac_DIABLO 6 150 7.1e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145152
SMART Domains Protein: ENSMUSP00000143617
Gene: ENSMUSG00000029433

DomainStartEndE-ValueType
Pfam:Smac_DIABLO 9 150 3.4e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196809
SMART Domains Protein: ENSMUSP00000143602
Gene: ENSMUSG00000063409

DomainStartEndE-ValueType
low complexity region 63 80 N/A INTRINSIC
SCOP:d1a9na_ 117 262 2e-16 SMART
low complexity region 389 402 N/A INTRINSIC
low complexity region 537 565 N/A INTRINSIC
low complexity region 635 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197682
Predicted Effect probably benign
Transcript: ENSMUST00000200247
SMART Domains Protein: ENSMUSP00000143673
Gene: ENSMUSG00000029433

DomainStartEndE-ValueType
Pfam:Smac_DIABLO 1 109 4.4e-57 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta-1,3-N-acetylglucosaminyltransferase protein family. The encoded enzyme is involved in the biosynthesis of poly-N-acetyllactosamine chains and prefers lacto-N-neotetraose as a substrate. It is a type II transmembrane protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C T 15: 58,022,509 V326M probably damaging Het
Adap2 T A 11: 80,156,959 H80Q probably benign Het
Ang4 T C 14: 51,764,486 T2A probably benign Het
Arf2 T C 11: 103,979,759 probably null Het
BC034090 T C 1: 155,226,357 I54V probably benign Het
Catsper3 A G 13: 55,804,895 T202A probably benign Het
Cenpe T A 3: 135,260,101 D2113E probably damaging Het
Clasp2 T C 9: 113,773,705 V191A probably benign Het
Col5a1 G T 2: 28,014,158 A1356S unknown Het
Cuzd1 A G 7: 131,308,848 S573P probably damaging Het
Cyp1a2 C A 9: 57,681,885 M215I possibly damaging Het
Dcaf17 T A 2: 71,063,402 I122K possibly damaging Het
Dhcr24 A G 4: 106,573,809 I232V probably benign Het
Dnah10 A G 5: 124,818,117 E3570G probably damaging Het
Dnaja4 A T 9: 54,714,704 probably benign Het
Ehd1 A G 19: 6,298,324 D444G probably damaging Het
Ehmt1 T A 2: 24,836,476 M766L possibly damaging Het
Eno4 A G 19: 58,970,722 I613M probably benign Het
Exoc3l A T 8: 105,290,549 M602K Het
Fam107a C T 14: 8,301,352 probably null Het
Frem3 A T 8: 80,613,148 D690V probably damaging Het
Gm11639 T C 11: 104,690,955 I41T probably benign Het
Gm19410 A T 8: 35,771,868 D97V probably damaging Het
Grik5 T A 7: 25,023,064 D540V possibly damaging Het
Hint1 T A 11: 54,869,943 D69E probably benign Het
Krt13 T C 11: 100,119,385 T257A probably benign Het
Lpin2 T C 17: 71,242,754 L676P probably damaging Het
Lrguk A G 6: 34,029,683 E76G probably benign Het
Lrrc8a A G 2: 30,256,298 M375V probably benign Het
Lrrtm3 T C 10: 64,089,238 Q50R possibly damaging Het
Mmrn1 T A 6: 60,976,529 L598Q probably damaging Het
Mrs2 A G 13: 25,001,784 I135T probably damaging Het
Neb T C 2: 52,235,580 D475G Het
Notch2 A G 3: 98,135,599 S1427G possibly damaging Het
Olfr118 C A 17: 37,672,411 Y129* probably null Het
Olfr682-ps1 A G 7: 105,126,686 V195A probably benign Het
Olfr694 A T 7: 106,689,089 I214N probably damaging Het
Olfr816 A G 10: 129,911,862 C139R probably damaging Het
Olfr952 A C 9: 39,426,219 V284G possibly damaging Het
Opcml T C 9: 28,902,151 F246S probably damaging Het
Pdzd2 C A 15: 12,402,319 V729F probably damaging Het
Pias2 C T 18: 77,146,768 Q565* probably null Het
Pnp T A 14: 50,950,720 probably null Het
Ptpn18 T C 1: 34,463,130 S76P probably benign Het
Qtrt2 A T 16: 43,863,197 L304Q probably damaging Het
Rad51ap2 A T 12: 11,457,400 E441V possibly damaging Het
Ranbp2 T A 10: 58,477,889 V1477E probably benign Het
Repin1 C T 6: 48,597,433 T432I possibly damaging Het
Rest G A 5: 77,282,511 G926R probably benign Het
Rnft1 T A 11: 86,486,690 F143L possibly damaging Het
Sema3e A T 5: 14,232,094 I415L probably benign Het
Slc10a1 T A 12: 80,967,595 N117I probably damaging Het
Slc25a23 G A 17: 57,059,709 probably benign Het
Slc2a2 T C 3: 28,713,802 S160P possibly damaging Het
Srrd A G 5: 112,338,456 V178A possibly damaging Het
Tmigd3 G T 3: 105,921,961 G198C probably benign Het
Trbv29 G A 6: 41,271,405 M1I probably null Het
Tril A G 6: 53,819,584 S218P probably damaging Het
Trip11 T C 12: 101,862,598 K1749R probably benign Het
Ttc25 G T 11: 100,566,926 E452* probably null Het
Ttn A G 2: 76,830,651 V12011A Het
Ubr4 T G 4: 139,410,518 F1093V probably benign Het
Urb2 C A 8: 124,028,403 A283E probably benign Het
Usp43 T A 11: 67,898,881 probably benign Het
Vmn1r28 A T 6: 58,265,684 I171F probably benign Het
Vps33a G A 5: 123,533,899 R469W probably damaging Het
Zfp202 G A 9: 40,211,757 R605Q probably damaging Het
Zpbp2 A T 11: 98,554,620 H158L probably benign Het
Other mutations in B3gnt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:B3gnt4 APN 5 123511068 missense probably damaging 1.00
IGL01791:B3gnt4 APN 5 123511099 missense probably damaging 1.00
IGL02825:B3gnt4 APN 5 123511051 missense possibly damaging 0.58
R1996:B3gnt4 UTSW 5 123511339 missense probably damaging 1.00
R2070:B3gnt4 UTSW 5 123511370 missense probably benign 0.00
R2071:B3gnt4 UTSW 5 123511370 missense probably benign 0.00
R2254:B3gnt4 UTSW 5 123511279 missense probably damaging 0.99
R2255:B3gnt4 UTSW 5 123511279 missense probably damaging 0.99
R3153:B3gnt4 UTSW 5 123510653 missense probably benign 0.00
R3608:B3gnt4 UTSW 5 123510775 missense probably damaging 1.00
R5021:B3gnt4 UTSW 5 123510947 missense probably damaging 0.98
R6438:B3gnt4 UTSW 5 123511591 missense probably benign 0.02
R6496:B3gnt4 UTSW 5 123511591 missense probably benign 0.02
R7427:B3gnt4 UTSW 5 123510731 missense probably damaging 0.99
R7428:B3gnt4 UTSW 5 123510731 missense probably damaging 0.99
R7573:B3gnt4 UTSW 5 123510655 missense probably benign
R8155:B3gnt4 UTSW 5 123511363 missense possibly damaging 0.93
R9682:B3gnt4 UTSW 5 123511453 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAAGCTGGTGTTCCTCCTG -3'
(R):5'- TAGCCTGGGACATGACGTAG -3'

Sequencing Primer
(F):5'- TTCCTCCTGGGGGTGGC -3'
(R):5'- GCCGCCTCCTGCATAAG -3'
Posted On 2021-07-15