Incidental Mutation 'R8879:Vps33a'
ID 676756
Institutional Source Beutler Lab
Gene Symbol Vps33a
Ensembl Gene ENSMUSG00000029434
Gene Name VPS33A CORVET/HOPS core subunit
Synonyms 3830421M04Rik, bf
MMRRC Submission 068747-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8879 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 123666820-123711104 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 123671962 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 469 (R469W)
Ref Sequence ENSEMBL: ENSMUSP00000031388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031388]
AlphaFold Q9D2N9
Predicted Effect probably damaging
Transcript: ENSMUST00000031388
AA Change: R469W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031388
Gene: ENSMUSG00000029434
AA Change: R469W

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
Pfam:Sec1 34 592 7.2e-104 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec-1 domain family, and it encodes a protein similar to the yeast class C Vps33 protein. The mammalian class C VPS proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene produce hypopigmentation, an extended bleeeding time and abnormal kidney function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C T 15: 57,885,905 (GRCm39) V326M probably damaging Het
Adap2 T A 11: 80,047,785 (GRCm39) H80Q probably benign Het
Ang4 T C 14: 52,001,943 (GRCm39) T2A probably benign Het
Arf2 T C 11: 103,870,585 (GRCm39) probably null Het
B3gnt4 A G 5: 123,649,211 (GRCm39) D192G probably damaging Het
BC034090 T C 1: 155,102,103 (GRCm39) I54V probably benign Het
Catsper3 A G 13: 55,952,708 (GRCm39) T202A probably benign Het
Cenpe T A 3: 134,965,862 (GRCm39) D2113E probably damaging Het
Clasp2 T C 9: 113,602,773 (GRCm39) V191A probably benign Het
Col5a1 G T 2: 27,904,170 (GRCm39) A1356S unknown Het
Cuzd1 A G 7: 130,910,577 (GRCm39) S573P probably damaging Het
Cyp1a2 C A 9: 57,589,168 (GRCm39) M215I possibly damaging Het
Dcaf17 T A 2: 70,893,746 (GRCm39) I122K possibly damaging Het
Dhcr24 A G 4: 106,431,006 (GRCm39) I232V probably benign Het
Dnah10 A G 5: 124,895,181 (GRCm39) E3570G probably damaging Het
Dnaja4 A T 9: 54,621,988 (GRCm39) probably benign Het
Efcab3 T C 11: 104,581,781 (GRCm39) I41T probably benign Het
Ehd1 A G 19: 6,348,354 (GRCm39) D444G probably damaging Het
Ehmt1 T A 2: 24,726,488 (GRCm39) M766L possibly damaging Het
Eno4 A G 19: 58,959,154 (GRCm39) I613M probably benign Het
Exoc3l A T 8: 106,017,181 (GRCm39) M602K Het
Fam107a C T 14: 8,301,352 (GRCm38) probably null Het
Frem3 A T 8: 81,339,777 (GRCm39) D690V probably damaging Het
Gm19410 A T 8: 36,239,022 (GRCm39) D97V probably damaging Het
Grik5 T A 7: 24,722,489 (GRCm39) D540V possibly damaging Het
Hint1 T A 11: 54,760,769 (GRCm39) D69E probably benign Het
Krt13 T C 11: 100,010,211 (GRCm39) T257A probably benign Het
Lpin2 T C 17: 71,549,749 (GRCm39) L676P probably damaging Het
Lrguk A G 6: 34,006,618 (GRCm39) E76G probably benign Het
Lrrc8a A G 2: 30,146,310 (GRCm39) M375V probably benign Het
Lrrtm3 T C 10: 63,925,017 (GRCm39) Q50R possibly damaging Het
Mmrn1 T A 6: 60,953,513 (GRCm39) L598Q probably damaging Het
Mrs2 A G 13: 25,185,767 (GRCm39) I135T probably damaging Het
Neb T C 2: 52,125,592 (GRCm39) D475G Het
Notch2 A G 3: 98,042,915 (GRCm39) S1427G possibly damaging Het
Odad4 G T 11: 100,457,752 (GRCm39) E452* probably null Het
Opcml T C 9: 28,813,447 (GRCm39) F246S probably damaging Het
Or10al2 C A 17: 37,983,302 (GRCm39) Y129* probably null Het
Or2ag1b A T 7: 106,288,296 (GRCm39) I214N probably damaging Het
Or56a42-ps1 A G 7: 104,775,893 (GRCm39) V195A probably benign Het
Or6c69 A G 10: 129,747,731 (GRCm39) C139R probably damaging Het
Or8g33 A C 9: 39,337,515 (GRCm39) V284G possibly damaging Het
Pdzd2 C A 15: 12,402,405 (GRCm39) V729F probably damaging Het
Pias2 C T 18: 77,234,464 (GRCm39) Q565* probably null Het
Pnp T A 14: 51,188,177 (GRCm39) probably null Het
Ptpn18 T C 1: 34,502,211 (GRCm39) S76P probably benign Het
Qtrt2 A T 16: 43,683,560 (GRCm39) L304Q probably damaging Het
Rad51ap2 A T 12: 11,507,401 (GRCm39) E441V possibly damaging Het
Ranbp2 T A 10: 58,313,711 (GRCm39) V1477E probably benign Het
Repin1 C T 6: 48,574,367 (GRCm39) T432I possibly damaging Het
Rest G A 5: 77,430,358 (GRCm39) G926R probably benign Het
Rnft1 T A 11: 86,377,516 (GRCm39) F143L possibly damaging Het
Sema3e A T 5: 14,282,108 (GRCm39) I415L probably benign Het
Slc10a1 T A 12: 81,014,369 (GRCm39) N117I probably damaging Het
Slc25a23 G A 17: 57,366,709 (GRCm39) probably benign Het
Slc2a2 T C 3: 28,767,951 (GRCm39) S160P possibly damaging Het
Srrd A G 5: 112,486,322 (GRCm39) V178A possibly damaging Het
Tmigd3 G T 3: 105,829,277 (GRCm39) G198C probably benign Het
Trbv28 G A 6: 41,248,339 (GRCm39) M1I probably null Het
Tril A G 6: 53,796,569 (GRCm39) S218P probably damaging Het
Trip11 T C 12: 101,828,857 (GRCm39) K1749R probably benign Het
Ttn A G 2: 76,660,995 (GRCm39) V12011A Het
Ubr4 T G 4: 139,137,829 (GRCm39) F1093V probably benign Het
Urb2 C A 8: 124,755,142 (GRCm39) A283E probably benign Het
Usp43 T A 11: 67,789,707 (GRCm39) probably benign Het
Vmn1r28 A T 6: 58,242,669 (GRCm39) I171F probably benign Het
Zfp202 G A 9: 40,123,053 (GRCm39) R605Q probably damaging Het
Zpbp2 A T 11: 98,445,446 (GRCm39) H158L probably benign Het
Other mutations in Vps33a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01345:Vps33a APN 5 123,711,006 (GRCm39) missense probably benign 0.00
IGL01459:Vps33a APN 5 123,673,371 (GRCm39) missense probably benign 0.08
IGL02473:Vps33a APN 5 123,707,634 (GRCm39) missense probably damaging 1.00
IGL02899:Vps33a APN 5 123,669,239 (GRCm39) missense probably damaging 1.00
R0498:Vps33a UTSW 5 123,709,024 (GRCm39) missense probably benign 0.40
R1134:Vps33a UTSW 5 123,708,975 (GRCm39) missense probably damaging 0.97
R1928:Vps33a UTSW 5 123,696,684 (GRCm39) missense probably benign 0.02
R2012:Vps33a UTSW 5 123,669,244 (GRCm39) splice site probably null
R2926:Vps33a UTSW 5 123,707,634 (GRCm39) missense possibly damaging 0.83
R3688:Vps33a UTSW 5 123,673,274 (GRCm39) splice site probably null
R3872:Vps33a UTSW 5 123,669,255 (GRCm39) missense probably benign 0.16
R4437:Vps33a UTSW 5 123,669,947 (GRCm39) missense probably benign
R5153:Vps33a UTSW 5 123,696,691 (GRCm39) missense probably damaging 1.00
R5396:Vps33a UTSW 5 123,696,693 (GRCm39) missense probably damaging 0.98
R5686:Vps33a UTSW 5 123,685,064 (GRCm39) critical splice donor site probably null
R5714:Vps33a UTSW 5 123,707,563 (GRCm39) missense probably benign
R5814:Vps33a UTSW 5 123,703,119 (GRCm39) missense probably damaging 1.00
R6845:Vps33a UTSW 5 123,673,335 (GRCm39) missense probably benign 0.02
R7183:Vps33a UTSW 5 123,673,278 (GRCm39) missense probably null 0.83
R7359:Vps33a UTSW 5 123,696,696 (GRCm39) missense probably benign 0.00
R7593:Vps33a UTSW 5 123,674,619 (GRCm39) missense probably benign 0.00
R7855:Vps33a UTSW 5 123,709,042 (GRCm39) missense possibly damaging 0.78
R7885:Vps33a UTSW 5 123,673,312 (GRCm39) missense possibly damaging 0.70
R8025:Vps33a UTSW 5 123,696,738 (GRCm39) missense possibly damaging 0.76
R8139:Vps33a UTSW 5 123,672,015 (GRCm39) missense probably benign 0.04
R8275:Vps33a UTSW 5 123,707,522 (GRCm39) missense probably damaging 0.99
R8434:Vps33a UTSW 5 123,671,944 (GRCm39) missense possibly damaging 0.74
R8845:Vps33a UTSW 5 123,709,538 (GRCm39) critical splice donor site probably null
R8880:Vps33a UTSW 5 123,707,506 (GRCm39) missense probably damaging 0.98
R9172:Vps33a UTSW 5 123,674,604 (GRCm39) missense probably benign 0.17
R9440:Vps33a UTSW 5 123,703,047 (GRCm39) missense probably damaging 1.00
R9502:Vps33a UTSW 5 123,696,705 (GRCm39) missense probably benign 0.00
R9725:Vps33a UTSW 5 123,669,135 (GRCm39) missense possibly damaging 0.95
X0026:Vps33a UTSW 5 123,685,160 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ACACACATGCACTGCTTTGC -3'
(R):5'- GAGTGCTCCTCTTTGGACATCTG -3'

Sequencing Primer
(F):5'- GGAACCAACTCCTGCAGGTTTC -3'
(R):5'- CCTCTTTGGACATCTGCAGGAG -3'
Posted On 2021-07-15