Incidental Mutation 'R8879:Repin1'
ID 676760
Institutional Source Beutler Lab
Gene Symbol Repin1
Ensembl Gene ENSMUSG00000052751
Gene Name replication initiator 1
Synonyms Zfp464, E430037F08Rik, AP4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8879 (G1)
Quality Score 212.009
Status Validated
Chromosome 6
Chromosomal Location 48593883-48599082 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 48597433 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 432 (T432I)
Ref Sequence ENSEMBL: ENSMUSP00000118890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009420] [ENSMUST00000118229] [ENSMUST00000135151] [ENSMUST00000154010] [ENSMUST00000163452] [ENSMUST00000204095] [ENSMUST00000204121] [ENSMUST00000204521]
AlphaFold Q5U4E2
Predicted Effect possibly damaging
Transcript: ENSMUST00000009420
AA Change: T376I

PolyPhen 2 Score 0.600 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000009420
Gene: ENSMUSG00000052751
AA Change: T376I

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
ZnF_C2H2 285 307 5.21e-4 SMART
ZnF_C2H2 353 375 4.72e-2 SMART
ZnF_C2H2 381 403 1.26e-2 SMART
ZnF_C2H2 409 431 1.79e-2 SMART
ZnF_C2H2 437 459 4.24e-4 SMART
ZnF_C2H2 465 487 6.52e-5 SMART
ZnF_C2H2 493 515 2.61e-4 SMART
ZnF_C2H2 521 543 1.45e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118229
AA Change: T429I

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113548
Gene: ENSMUSG00000052751
AA Change: T429I

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
ZnF_C2H2 285 307 5.21e-4 SMART
ZnF_C2H2 353 375 4.72e-2 SMART
ZnF_C2H2 381 403 1.26e-2 SMART
ZnF_C2H2 409 431 1.79e-2 SMART
ZnF_C2H2 437 459 4.24e-4 SMART
ZnF_C2H2 465 487 6.52e-5 SMART
ZnF_C2H2 493 515 2.61e-4 SMART
ZnF_C2H2 521 543 1.45e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000135151
AA Change: T432I

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118890
Gene: ENSMUSG00000052751
AA Change: T432I

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
Pfam:zf-C2H2_6 284 300 1.4e-1 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154010
SMART Domains Protein: ENSMUSP00000121975
Gene: ENSMUSG00000052751

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
ZnF_C2H2 285 307 5.21e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163452
AA Change: T376I

PolyPhen 2 Score 0.600 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132365
Gene: ENSMUSG00000052751
AA Change: T376I

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
ZnF_C2H2 285 307 5.21e-4 SMART
ZnF_C2H2 353 375 4.72e-2 SMART
ZnF_C2H2 381 403 1.26e-2 SMART
ZnF_C2H2 409 431 1.79e-2 SMART
ZnF_C2H2 437 459 4.24e-4 SMART
ZnF_C2H2 465 487 6.52e-5 SMART
ZnF_C2H2 493 515 2.61e-4 SMART
ZnF_C2H2 521 543 1.45e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204095
SMART Domains Protein: ENSMUSP00000145192
Gene: ENSMUSG00000007216

DomainStartEndE-ValueType
low complexity region 86 102 N/A INTRINSIC
ZnF_C2H2 104 126 7.9e-4 SMART
ZnF_C2H2 132 154 1.69e-3 SMART
ZnF_C2H2 160 182 2.36e-2 SMART
ZnF_C2H2 188 210 4.11e-2 SMART
ZnF_C2H2 279 301 1.84e-4 SMART
ZnF_C2H2 307 329 4.94e-5 SMART
ZnF_C2H2 335 357 2.95e-3 SMART
ZnF_C2H2 364 386 1.36e-2 SMART
ZnF_C2H2 446 468 1.3e-4 SMART
ZnF_C2H2 474 496 2.12e-4 SMART
ZnF_C2H2 502 524 5.5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204121
Predicted Effect probably benign
Transcript: ENSMUST00000204521
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (69/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele improves in insulin sensitivity and glucose metabolism in Leprdb homozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C T 15: 58,022,509 V326M probably damaging Het
Adap2 T A 11: 80,156,959 H80Q probably benign Het
Ang4 T C 14: 51,764,486 T2A probably benign Het
Arf2 T C 11: 103,979,759 probably null Het
B3gnt4 A G 5: 123,511,148 D192G probably damaging Het
BC034090 T C 1: 155,226,357 I54V probably benign Het
Catsper3 A G 13: 55,804,895 T202A probably benign Het
Cenpe T A 3: 135,260,101 D2113E probably damaging Het
Clasp2 T C 9: 113,773,705 V191A probably benign Het
Col5a1 G T 2: 28,014,158 A1356S unknown Het
Cuzd1 A G 7: 131,308,848 S573P probably damaging Het
Cyp1a2 C A 9: 57,681,885 M215I possibly damaging Het
Dcaf17 T A 2: 71,063,402 I122K possibly damaging Het
Dhcr24 A G 4: 106,573,809 I232V probably benign Het
Dnah10 A G 5: 124,818,117 E3570G probably damaging Het
Dnaja4 A T 9: 54,714,704 probably benign Het
Ehd1 A G 19: 6,298,324 D444G probably damaging Het
Ehmt1 T A 2: 24,836,476 M766L possibly damaging Het
Eno4 A G 19: 58,970,722 I613M probably benign Het
Exoc3l A T 8: 105,290,549 M602K Het
Fam107a C T 14: 8,301,352 probably null Het
Frem3 A T 8: 80,613,148 D690V probably damaging Het
Gm11639 T C 11: 104,690,955 I41T probably benign Het
Gm19410 A T 8: 35,771,868 D97V probably damaging Het
Grik5 T A 7: 25,023,064 D540V possibly damaging Het
Hint1 T A 11: 54,869,943 D69E probably benign Het
Krt13 T C 11: 100,119,385 T257A probably benign Het
Lpin2 T C 17: 71,242,754 L676P probably damaging Het
Lrguk A G 6: 34,029,683 E76G probably benign Het
Lrrc8a A G 2: 30,256,298 M375V probably benign Het
Lrrtm3 T C 10: 64,089,238 Q50R possibly damaging Het
Mmrn1 T A 6: 60,976,529 L598Q probably damaging Het
Mrs2 A G 13: 25,001,784 I135T probably damaging Het
Neb T C 2: 52,235,580 D475G Het
Notch2 A G 3: 98,135,599 S1427G possibly damaging Het
Olfr118 C A 17: 37,672,411 Y129* probably null Het
Olfr682-ps1 A G 7: 105,126,686 V195A probably benign Het
Olfr694 A T 7: 106,689,089 I214N probably damaging Het
Olfr816 A G 10: 129,911,862 C139R probably damaging Het
Olfr952 A C 9: 39,426,219 V284G possibly damaging Het
Opcml T C 9: 28,902,151 F246S probably damaging Het
Pdzd2 C A 15: 12,402,319 V729F probably damaging Het
Pias2 C T 18: 77,146,768 Q565* probably null Het
Pnp T A 14: 50,950,720 probably null Het
Ptpn18 T C 1: 34,463,130 S76P probably benign Het
Qtrt2 A T 16: 43,863,197 L304Q probably damaging Het
Rad51ap2 A T 12: 11,457,400 E441V possibly damaging Het
Ranbp2 T A 10: 58,477,889 V1477E probably benign Het
Rest G A 5: 77,282,511 G926R probably benign Het
Rnft1 T A 11: 86,486,690 F143L possibly damaging Het
Sema3e A T 5: 14,232,094 I415L probably benign Het
Slc10a1 T A 12: 80,967,595 N117I probably damaging Het
Slc25a23 G A 17: 57,059,709 probably benign Het
Slc2a2 T C 3: 28,713,802 S160P possibly damaging Het
Srrd A G 5: 112,338,456 V178A possibly damaging Het
Tmigd3 G T 3: 105,921,961 G198C probably benign Het
Trbv29 G A 6: 41,271,405 M1I probably null Het
Tril A G 6: 53,819,584 S218P probably damaging Het
Trip11 T C 12: 101,862,598 K1749R probably benign Het
Ttc25 G T 11: 100,566,926 E452* probably null Het
Ttn A G 2: 76,830,651 V12011A Het
Ubr4 T G 4: 139,410,518 F1093V probably benign Het
Urb2 C A 8: 124,028,403 A283E probably benign Het
Usp43 T A 11: 67,898,881 probably benign Het
Vmn1r28 A T 6: 58,265,684 I171F probably benign Het
Vps33a G A 5: 123,533,899 R469W probably damaging Het
Zfp202 G A 9: 40,211,757 R605Q probably damaging Het
Zpbp2 A T 11: 98,554,620 H158L probably benign Het
Other mutations in Repin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Repin1 APN 6 48596905 missense probably damaging 1.00
IGL01103:Repin1 APN 6 48597953 intron probably benign
IGL02027:Repin1 APN 6 48596473 missense probably damaging 1.00
IGL02143:Repin1 APN 6 48597121 missense probably damaging 1.00
R0395:Repin1 UTSW 6 48597525 missense probably damaging 1.00
R1233:Repin1 UTSW 6 48597834 missense possibly damaging 0.72
R1743:Repin1 UTSW 6 48597750 missense probably damaging 0.96
R2259:Repin1 UTSW 6 48596530 missense probably benign 0.00
R4509:Repin1 UTSW 6 48596526 missense possibly damaging 0.77
R5008:Repin1 UTSW 6 48596608 missense probably damaging 1.00
R5009:Repin1 UTSW 6 48594845 intron probably benign
R5425:Repin1 UTSW 6 48596431 missense probably benign 0.18
R5829:Repin1 UTSW 6 48594832 intron probably benign
R6350:Repin1 UTSW 6 48597628 missense probably damaging 0.98
R6841:Repin1 UTSW 6 48597925 missense possibly damaging 0.95
R6854:Repin1 UTSW 6 48593891 intron probably benign
R7067:Repin1 UTSW 6 48597916 nonsense probably null
R7636:Repin1 UTSW 6 48596365 missense probably benign 0.00
R7699:Repin1 UTSW 6 48597822 missense probably damaging 0.96
R7700:Repin1 UTSW 6 48597822 missense probably damaging 0.96
R7747:Repin1 UTSW 6 48597345 nonsense probably null
R7748:Repin1 UTSW 6 48597345 nonsense probably null
R7781:Repin1 UTSW 6 48597345 nonsense probably null
R7815:Repin1 UTSW 6 48597345 nonsense probably null
R7820:Repin1 UTSW 6 48597345 nonsense probably null
R7869:Repin1 UTSW 6 48597345 nonsense probably null
R7988:Repin1 UTSW 6 48597345 nonsense probably null
R7991:Repin1 UTSW 6 48597345 nonsense probably null
R8078:Repin1 UTSW 6 48597345 nonsense probably null
R8079:Repin1 UTSW 6 48597345 nonsense probably null
R8080:Repin1 UTSW 6 48597345 nonsense probably null
R8088:Repin1 UTSW 6 48597345 nonsense probably null
R8089:Repin1 UTSW 6 48597345 nonsense probably null
R8130:Repin1 UTSW 6 48597345 nonsense probably null
R8131:Repin1 UTSW 6 48597345 nonsense probably null
R8324:Repin1 UTSW 6 48597345 nonsense probably null
R8325:Repin1 UTSW 6 48597345 nonsense probably null
R8342:Repin1 UTSW 6 48597345 nonsense probably null
R8411:Repin1 UTSW 6 48597345 nonsense probably null
R8488:Repin1 UTSW 6 48594018 missense probably damaging 0.98
R8542:Repin1 UTSW 6 48597345 nonsense probably null
R8543:Repin1 UTSW 6 48597345 nonsense probably null
R8544:Repin1 UTSW 6 48597345 nonsense probably null
R8697:Repin1 UTSW 6 48597345 nonsense probably null
R8699:Repin1 UTSW 6 48597345 nonsense probably null
R8701:Repin1 UTSW 6 48597345 nonsense probably null
R8702:Repin1 UTSW 6 48597345 nonsense probably null
R8731:Repin1 UTSW 6 48597345 nonsense probably null
R8732:Repin1 UTSW 6 48597345 nonsense probably null
R8780:Repin1 UTSW 6 48597139 missense probably damaging 0.99
R9049:Repin1 UTSW 6 48597712 missense possibly damaging 0.86
R9465:Repin1 UTSW 6 48594943 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GAGAGTCACCAGATTGCAGC -3'
(R):5'- CACACATAGGGTTTCTCGCCTG -3'

Sequencing Primer
(F):5'- CCAGATTGCAGCAGAGCCTATG -3'
(R):5'- AAAGCCTTGCCGCAGTC -3'
Posted On 2021-07-15