Incidental Mutation 'R8879:Tril'
ID 676761
Institutional Source Beutler Lab
Gene Symbol Tril
Ensembl Gene ENSMUSG00000043496
Gene Name TLR4 interactor with leucine-rich repeats
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock # R8879 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 53815468-53820830 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 53819584 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 218 (S218P)
Ref Sequence ENSEMBL: ENSMUSP00000116056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127748]
AlphaFold Q9DBY4
Predicted Effect probably damaging
Transcript: ENSMUST00000127748
AA Change: S218P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116056
Gene: ENSMUSG00000043496
AA Change: S218P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 26 58 1.91e-1 SMART
LRR_TYP 82 105 3.49e-5 SMART
LRR_TYP 106 129 2.91e-2 SMART
LRR 130 153 9.96e-1 SMART
LRR 154 177 2.49e-1 SMART
LRR_TYP 178 201 1.67e-2 SMART
LRR 202 227 1.09e2 SMART
LRR_TYP 228 251 4.47e-3 SMART
LRR_TYP 252 275 1.84e-4 SMART
LRR 276 299 7.05e-1 SMART
LRR_TYP 300 323 1.3e-4 SMART
LRR 325 347 1.12e1 SMART
LRRCT 359 415 1.02e-2 SMART
low complexity region 448 465 N/A INTRINSIC
low complexity region 488 506 N/A INTRINSIC
low complexity region 554 569 N/A INTRINSIC
Blast:FN3 582 667 8e-34 BLAST
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 720 732 N/A INTRINSIC
low complexity region 788 796 N/A INTRINSIC
Meta Mutation Damage Score 0.1067 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TRIL is a component of the TLR4 (MIM 603030) complex and is induced in a number of cell types by lipopolysaccharide (LPS) (Carpenter et al., 2009 [PubMed 19710467]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C T 15: 58,022,509 V326M probably damaging Het
Adap2 T A 11: 80,156,959 H80Q probably benign Het
Ang4 T C 14: 51,764,486 T2A probably benign Het
Arf2 T C 11: 103,979,759 probably null Het
B3gnt4 A G 5: 123,511,148 D192G probably damaging Het
BC034090 T C 1: 155,226,357 I54V probably benign Het
Catsper3 A G 13: 55,804,895 T202A probably benign Het
Cenpe T A 3: 135,260,101 D2113E probably damaging Het
Clasp2 T C 9: 113,773,705 V191A probably benign Het
Col5a1 G T 2: 28,014,158 A1356S unknown Het
Cuzd1 A G 7: 131,308,848 S573P probably damaging Het
Cyp1a2 C A 9: 57,681,885 M215I possibly damaging Het
Dcaf17 T A 2: 71,063,402 I122K possibly damaging Het
Dhcr24 A G 4: 106,573,809 I232V probably benign Het
Dnah10 A G 5: 124,818,117 E3570G probably damaging Het
Dnaja4 A T 9: 54,714,704 probably benign Het
Ehd1 A G 19: 6,298,324 D444G probably damaging Het
Ehmt1 T A 2: 24,836,476 M766L possibly damaging Het
Eno4 A G 19: 58,970,722 I613M probably benign Het
Exoc3l A T 8: 105,290,549 M602K Het
Fam107a C T 14: 8,301,352 probably null Het
Frem3 A T 8: 80,613,148 D690V probably damaging Het
Gm11639 T C 11: 104,690,955 I41T probably benign Het
Gm19410 A T 8: 35,771,868 D97V probably damaging Het
Grik5 T A 7: 25,023,064 D540V possibly damaging Het
Hint1 T A 11: 54,869,943 D69E probably benign Het
Krt13 T C 11: 100,119,385 T257A probably benign Het
Lpin2 T C 17: 71,242,754 L676P probably damaging Het
Lrguk A G 6: 34,029,683 E76G probably benign Het
Lrrc8a A G 2: 30,256,298 M375V probably benign Het
Lrrtm3 T C 10: 64,089,238 Q50R possibly damaging Het
Mmrn1 T A 6: 60,976,529 L598Q probably damaging Het
Mrs2 A G 13: 25,001,784 I135T probably damaging Het
Neb T C 2: 52,235,580 D475G Het
Notch2 A G 3: 98,135,599 S1427G possibly damaging Het
Olfr118 C A 17: 37,672,411 Y129* probably null Het
Olfr682-ps1 A G 7: 105,126,686 V195A probably benign Het
Olfr694 A T 7: 106,689,089 I214N probably damaging Het
Olfr816 A G 10: 129,911,862 C139R probably damaging Het
Olfr952 A C 9: 39,426,219 V284G possibly damaging Het
Opcml T C 9: 28,902,151 F246S probably damaging Het
Pdzd2 C A 15: 12,402,319 V729F probably damaging Het
Pias2 C T 18: 77,146,768 Q565* probably null Het
Pnp T A 14: 50,950,720 probably null Het
Ptpn18 T C 1: 34,463,130 S76P probably benign Het
Qtrt2 A T 16: 43,863,197 L304Q probably damaging Het
Rad51ap2 A T 12: 11,457,400 E441V possibly damaging Het
Ranbp2 T A 10: 58,477,889 V1477E probably benign Het
Repin1 C T 6: 48,597,433 T432I possibly damaging Het
Rest G A 5: 77,282,511 G926R probably benign Het
Rnft1 T A 11: 86,486,690 F143L possibly damaging Het
Sema3e A T 5: 14,232,094 I415L probably benign Het
Slc10a1 T A 12: 80,967,595 N117I probably damaging Het
Slc25a23 G A 17: 57,059,709 probably benign Het
Slc2a2 T C 3: 28,713,802 S160P possibly damaging Het
Srrd A G 5: 112,338,456 V178A possibly damaging Het
Tmigd3 G T 3: 105,921,961 G198C probably benign Het
Trbv29 G A 6: 41,271,405 M1I probably null Het
Trip11 T C 12: 101,862,598 K1749R probably benign Het
Ttc25 G T 11: 100,566,926 E452* probably null Het
Ttn A G 2: 76,830,651 V12011A Het
Ubr4 T G 4: 139,410,518 F1093V probably benign Het
Urb2 C A 8: 124,028,403 A283E probably benign Het
Usp43 T A 11: 67,898,881 probably benign Het
Vmn1r28 A T 6: 58,265,684 I171F probably benign Het
Vps33a G A 5: 123,533,899 R469W probably damaging Het
Zfp202 G A 9: 40,211,757 R605Q probably damaging Het
Zpbp2 A T 11: 98,554,620 H158L probably benign Het
Other mutations in Tril
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Tril APN 6 53819038 missense probably damaging 1.00
IGL03399:Tril APN 6 53820057 missense probably benign 0.01
R0036:Tril UTSW 6 53818633 missense probably benign
R0099:Tril UTSW 6 53818363 missense probably damaging 0.99
R0448:Tril UTSW 6 53817808 makesense probably null
R0759:Tril UTSW 6 53818027 missense probably damaging 0.98
R1296:Tril UTSW 6 53818027 missense probably damaging 0.98
R1472:Tril UTSW 6 53818027 missense probably damaging 0.98
R1888:Tril UTSW 6 53819592 missense probably damaging 1.00
R1888:Tril UTSW 6 53819592 missense probably damaging 1.00
R2108:Tril UTSW 6 53819083 missense probably damaging 1.00
R2290:Tril UTSW 6 53818027 missense probably damaging 0.98
R2291:Tril UTSW 6 53818027 missense probably damaging 0.98
R2367:Tril UTSW 6 53819166 missense probably damaging 1.00
R4021:Tril UTSW 6 53819019 missense probably damaging 1.00
R4753:Tril UTSW 6 53819713 missense probably damaging 1.00
R4755:Tril UTSW 6 53818464 missense probably damaging 0.99
R4981:Tril UTSW 6 53818920 missense probably benign 0.10
R5468:Tril UTSW 6 53819647 missense probably damaging 1.00
R5653:Tril UTSW 6 53817985 missense probably benign 0.32
R6434:Tril UTSW 6 53818508 missense probably damaging 1.00
R6724:Tril UTSW 6 53819574 missense possibly damaging 0.94
R7401:Tril UTSW 6 53818281 missense possibly damaging 0.54
R7582:Tril UTSW 6 53818936 missense probably benign
R8339:Tril UTSW 6 53817933 missense possibly damaging 0.84
R8544:Tril UTSW 6 53819310 missense possibly damaging 0.93
R8721:Tril UTSW 6 53820198 missense probably benign 0.02
R8904:Tril UTSW 6 53820217 missense possibly damaging 0.51
R9147:Tril UTSW 6 53818152 missense probably damaging 1.00
R9148:Tril UTSW 6 53818152 missense probably damaging 1.00
R9740:Tril UTSW 6 53818119 missense possibly damaging 0.90
Z1088:Tril UTSW 6 53818920 missense probably benign 0.45
Z1177:Tril UTSW 6 53819644 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TTCAGCCGGTTACCTTCCAG -3'
(R):5'- AGAGTTTGGTCAAGCTACGGC -3'

Sequencing Primer
(F):5'- GTTACCTTCCAGGCGCAG -3'
(R):5'- TACGGCTGGACGGGAAC -3'
Posted On 2021-07-15