Incidental Mutation 'R8879:Tril'
ID 676761
Institutional Source Beutler Lab
Gene Symbol Tril
Ensembl Gene ENSMUSG00000043496
Gene Name TLR4 interactor with leucine-rich repeats
Synonyms 1200009O22Rik
MMRRC Submission 068747-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.186) question?
Stock # R8879 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 53792453-53797810 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 53796569 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 218 (S218P)
Ref Sequence ENSEMBL: ENSMUSP00000116056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127748]
AlphaFold Q9DBY4
Predicted Effect probably damaging
Transcript: ENSMUST00000127748
AA Change: S218P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116056
Gene: ENSMUSG00000043496
AA Change: S218P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 26 58 1.91e-1 SMART
LRR_TYP 82 105 3.49e-5 SMART
LRR_TYP 106 129 2.91e-2 SMART
LRR 130 153 9.96e-1 SMART
LRR 154 177 2.49e-1 SMART
LRR_TYP 178 201 1.67e-2 SMART
LRR 202 227 1.09e2 SMART
LRR_TYP 228 251 4.47e-3 SMART
LRR_TYP 252 275 1.84e-4 SMART
LRR 276 299 7.05e-1 SMART
LRR_TYP 300 323 1.3e-4 SMART
LRR 325 347 1.12e1 SMART
LRRCT 359 415 1.02e-2 SMART
low complexity region 448 465 N/A INTRINSIC
low complexity region 488 506 N/A INTRINSIC
low complexity region 554 569 N/A INTRINSIC
Blast:FN3 582 667 8e-34 BLAST
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 720 732 N/A INTRINSIC
low complexity region 788 796 N/A INTRINSIC
Meta Mutation Damage Score 0.1067 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TRIL is a component of the TLR4 (MIM 603030) complex and is induced in a number of cell types by lipopolysaccharide (LPS) (Carpenter et al., 2009 [PubMed 19710467]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C T 15: 57,885,905 (GRCm39) V326M probably damaging Het
Adap2 T A 11: 80,047,785 (GRCm39) H80Q probably benign Het
Ang4 T C 14: 52,001,943 (GRCm39) T2A probably benign Het
Arf2 T C 11: 103,870,585 (GRCm39) probably null Het
B3gnt4 A G 5: 123,649,211 (GRCm39) D192G probably damaging Het
BC034090 T C 1: 155,102,103 (GRCm39) I54V probably benign Het
Catsper3 A G 13: 55,952,708 (GRCm39) T202A probably benign Het
Cenpe T A 3: 134,965,862 (GRCm39) D2113E probably damaging Het
Clasp2 T C 9: 113,602,773 (GRCm39) V191A probably benign Het
Col5a1 G T 2: 27,904,170 (GRCm39) A1356S unknown Het
Cuzd1 A G 7: 130,910,577 (GRCm39) S573P probably damaging Het
Cyp1a2 C A 9: 57,589,168 (GRCm39) M215I possibly damaging Het
Dcaf17 T A 2: 70,893,746 (GRCm39) I122K possibly damaging Het
Dhcr24 A G 4: 106,431,006 (GRCm39) I232V probably benign Het
Dnah10 A G 5: 124,895,181 (GRCm39) E3570G probably damaging Het
Dnaja4 A T 9: 54,621,988 (GRCm39) probably benign Het
Efcab3 T C 11: 104,581,781 (GRCm39) I41T probably benign Het
Ehd1 A G 19: 6,348,354 (GRCm39) D444G probably damaging Het
Ehmt1 T A 2: 24,726,488 (GRCm39) M766L possibly damaging Het
Eno4 A G 19: 58,959,154 (GRCm39) I613M probably benign Het
Exoc3l A T 8: 106,017,181 (GRCm39) M602K Het
Fam107a C T 14: 8,301,352 (GRCm38) probably null Het
Frem3 A T 8: 81,339,777 (GRCm39) D690V probably damaging Het
Gm19410 A T 8: 36,239,022 (GRCm39) D97V probably damaging Het
Grik5 T A 7: 24,722,489 (GRCm39) D540V possibly damaging Het
Hint1 T A 11: 54,760,769 (GRCm39) D69E probably benign Het
Krt13 T C 11: 100,010,211 (GRCm39) T257A probably benign Het
Lpin2 T C 17: 71,549,749 (GRCm39) L676P probably damaging Het
Lrguk A G 6: 34,006,618 (GRCm39) E76G probably benign Het
Lrrc8a A G 2: 30,146,310 (GRCm39) M375V probably benign Het
Lrrtm3 T C 10: 63,925,017 (GRCm39) Q50R possibly damaging Het
Mmrn1 T A 6: 60,953,513 (GRCm39) L598Q probably damaging Het
Mrs2 A G 13: 25,185,767 (GRCm39) I135T probably damaging Het
Neb T C 2: 52,125,592 (GRCm39) D475G Het
Notch2 A G 3: 98,042,915 (GRCm39) S1427G possibly damaging Het
Odad4 G T 11: 100,457,752 (GRCm39) E452* probably null Het
Opcml T C 9: 28,813,447 (GRCm39) F246S probably damaging Het
Or10al2 C A 17: 37,983,302 (GRCm39) Y129* probably null Het
Or2ag1b A T 7: 106,288,296 (GRCm39) I214N probably damaging Het
Or56a42-ps1 A G 7: 104,775,893 (GRCm39) V195A probably benign Het
Or6c69 A G 10: 129,747,731 (GRCm39) C139R probably damaging Het
Or8g33 A C 9: 39,337,515 (GRCm39) V284G possibly damaging Het
Pdzd2 C A 15: 12,402,405 (GRCm39) V729F probably damaging Het
Pias2 C T 18: 77,234,464 (GRCm39) Q565* probably null Het
Pnp T A 14: 51,188,177 (GRCm39) probably null Het
Ptpn18 T C 1: 34,502,211 (GRCm39) S76P probably benign Het
Qtrt2 A T 16: 43,683,560 (GRCm39) L304Q probably damaging Het
Rad51ap2 A T 12: 11,507,401 (GRCm39) E441V possibly damaging Het
Ranbp2 T A 10: 58,313,711 (GRCm39) V1477E probably benign Het
Repin1 C T 6: 48,574,367 (GRCm39) T432I possibly damaging Het
Rest G A 5: 77,430,358 (GRCm39) G926R probably benign Het
Rnft1 T A 11: 86,377,516 (GRCm39) F143L possibly damaging Het
Sema3e A T 5: 14,282,108 (GRCm39) I415L probably benign Het
Slc10a1 T A 12: 81,014,369 (GRCm39) N117I probably damaging Het
Slc25a23 G A 17: 57,366,709 (GRCm39) probably benign Het
Slc2a2 T C 3: 28,767,951 (GRCm39) S160P possibly damaging Het
Srrd A G 5: 112,486,322 (GRCm39) V178A possibly damaging Het
Tmigd3 G T 3: 105,829,277 (GRCm39) G198C probably benign Het
Trbv28 G A 6: 41,248,339 (GRCm39) M1I probably null Het
Trip11 T C 12: 101,828,857 (GRCm39) K1749R probably benign Het
Ttn A G 2: 76,660,995 (GRCm39) V12011A Het
Ubr4 T G 4: 139,137,829 (GRCm39) F1093V probably benign Het
Urb2 C A 8: 124,755,142 (GRCm39) A283E probably benign Het
Usp43 T A 11: 67,789,707 (GRCm39) probably benign Het
Vmn1r28 A T 6: 58,242,669 (GRCm39) I171F probably benign Het
Vps33a G A 5: 123,671,962 (GRCm39) R469W probably damaging Het
Zfp202 G A 9: 40,123,053 (GRCm39) R605Q probably damaging Het
Zpbp2 A T 11: 98,445,446 (GRCm39) H158L probably benign Het
Other mutations in Tril
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Tril APN 6 53,796,023 (GRCm39) missense probably damaging 1.00
IGL03399:Tril APN 6 53,797,042 (GRCm39) missense probably benign 0.01
R0036:Tril UTSW 6 53,795,618 (GRCm39) missense probably benign
R0099:Tril UTSW 6 53,795,348 (GRCm39) missense probably damaging 0.99
R0448:Tril UTSW 6 53,794,793 (GRCm39) makesense probably null
R0759:Tril UTSW 6 53,795,012 (GRCm39) missense probably damaging 0.98
R1296:Tril UTSW 6 53,795,012 (GRCm39) missense probably damaging 0.98
R1472:Tril UTSW 6 53,795,012 (GRCm39) missense probably damaging 0.98
R1888:Tril UTSW 6 53,796,577 (GRCm39) missense probably damaging 1.00
R1888:Tril UTSW 6 53,796,577 (GRCm39) missense probably damaging 1.00
R2108:Tril UTSW 6 53,796,068 (GRCm39) missense probably damaging 1.00
R2290:Tril UTSW 6 53,795,012 (GRCm39) missense probably damaging 0.98
R2291:Tril UTSW 6 53,795,012 (GRCm39) missense probably damaging 0.98
R2367:Tril UTSW 6 53,796,151 (GRCm39) missense probably damaging 1.00
R4021:Tril UTSW 6 53,796,004 (GRCm39) missense probably damaging 1.00
R4753:Tril UTSW 6 53,796,698 (GRCm39) missense probably damaging 1.00
R4755:Tril UTSW 6 53,795,449 (GRCm39) missense probably damaging 0.99
R4981:Tril UTSW 6 53,795,905 (GRCm39) missense probably benign 0.10
R5468:Tril UTSW 6 53,796,632 (GRCm39) missense probably damaging 1.00
R5653:Tril UTSW 6 53,794,970 (GRCm39) missense probably benign 0.32
R6434:Tril UTSW 6 53,795,493 (GRCm39) missense probably damaging 1.00
R6724:Tril UTSW 6 53,796,559 (GRCm39) missense possibly damaging 0.94
R7401:Tril UTSW 6 53,795,266 (GRCm39) missense possibly damaging 0.54
R7582:Tril UTSW 6 53,795,921 (GRCm39) missense probably benign
R8339:Tril UTSW 6 53,794,918 (GRCm39) missense possibly damaging 0.84
R8544:Tril UTSW 6 53,796,295 (GRCm39) missense possibly damaging 0.93
R8721:Tril UTSW 6 53,797,183 (GRCm39) missense probably benign 0.02
R8904:Tril UTSW 6 53,797,202 (GRCm39) missense possibly damaging 0.51
R9147:Tril UTSW 6 53,795,137 (GRCm39) missense probably damaging 1.00
R9148:Tril UTSW 6 53,795,137 (GRCm39) missense probably damaging 1.00
R9740:Tril UTSW 6 53,795,104 (GRCm39) missense possibly damaging 0.90
Z1088:Tril UTSW 6 53,795,905 (GRCm39) missense probably benign 0.45
Z1177:Tril UTSW 6 53,796,629 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TTCAGCCGGTTACCTTCCAG -3'
(R):5'- AGAGTTTGGTCAAGCTACGGC -3'

Sequencing Primer
(F):5'- GTTACCTTCCAGGCGCAG -3'
(R):5'- TACGGCTGGACGGGAAC -3'
Posted On 2021-07-15