Mutagenetix > Incidental Mutation

Incidental Mutation 'R8879:Gm19410'

676768

Institutional Source

Beutler Lab

Gene Symbol

Gm19410

Ensembl Gene

ENSMUSG00000109372

Gene Name

predicted gene, 19410

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R8879 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

35765790-35818047 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 35771868 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 97 (D97V)

Ref Sequence

ENSEMBL: ENSMUSP00000147162 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000207505]

AlphaFold

A0A140LJC7

Predicted Effect

probably damaging
Transcript: ENSMUST00000207505
AA Change: D97V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

Meta Mutation Damage Score

0.9672

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (69/69)

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130401M01Rik	C	T	15: 58,022,509	V326M	probably damaging	Het
Adap2	T	A	11: 80,156,959	H80Q	probably benign	Het
Ang4	T	C	14: 51,764,486	T2A	probably benign	Het
Arf2	T	C	11: 103,979,759		probably null	Het
B3gnt4	A	G	5: 123,511,148	D192G	probably damaging	Het
BC034090	T	C	1: 155,226,357	I54V	probably benign	Het
Catsper3	A	G	13: 55,804,895	T202A	probably benign	Het
Cenpe	T	A	3: 135,260,101	D2113E	probably damaging	Het
Clasp2	T	C	9: 113,773,705	V191A	probably benign	Het
Col5a1	G	T	2: 28,014,158	A1356S	unknown	Het
Cuzd1	A	G	7: 131,308,848	S573P	probably damaging	Het
Cyp1a2	C	A	9: 57,681,885	M215I	possibly damaging	Het
Dcaf17	T	A	2: 71,063,402	I122K	possibly damaging	Het
Dhcr24	A	G	4: 106,573,809	I232V	probably benign	Het
Dnah10	A	G	5: 124,818,117	E3570G	probably damaging	Het
Dnaja4	A	T	9: 54,714,704		probably benign	Het
Ehd1	A	G	19: 6,298,324	D444G	probably damaging	Het
Ehmt1	T	A	2: 24,836,476	M766L	possibly damaging	Het
Eno4	A	G	19: 58,970,722	I613M	probably benign	Het
Exoc3l	A	T	8: 105,290,549	M602K		Het
Fam107a	C	T	14: 8,301,352		probably null	Het
Frem3	A	T	8: 80,613,148	D690V	probably damaging	Het
Gm11639	T	C	11: 104,690,955	I41T	probably benign	Het
Grik5	T	A	7: 25,023,064	D540V	possibly damaging	Het
Hint1	T	A	11: 54,869,943	D69E	probably benign	Het
Krt13	T	C	11: 100,119,385	T257A	probably benign	Het
Lpin2	T	C	17: 71,242,754	L676P	probably damaging	Het
Lrguk	A	G	6: 34,029,683	E76G	probably benign	Het
Lrrc8a	A	G	2: 30,256,298	M375V	probably benign	Het
Lrrtm3	T	C	10: 64,089,238	Q50R	possibly damaging	Het
Mmrn1	T	A	6: 60,976,529	L598Q	probably damaging	Het
Mrs2	A	G	13: 25,001,784	I135T	probably damaging	Het
Neb	T	C	2: 52,235,580	D475G		Het
Notch2	A	G	3: 98,135,599	S1427G	possibly damaging	Het
Olfr118	C	A	17: 37,672,411	Y129*	probably null	Het
Olfr682-ps1	A	G	7: 105,126,686	V195A	probably benign	Het
Olfr694	A	T	7: 106,689,089	I214N	probably damaging	Het
Olfr816	A	G	10: 129,911,862	C139R	probably damaging	Het
Olfr952	A	C	9: 39,426,219	V284G	possibly damaging	Het
Opcml	T	C	9: 28,902,151	F246S	probably damaging	Het
Pdzd2	C	A	15: 12,402,319	V729F	probably damaging	Het
Pias2	C	T	18: 77,146,768	Q565*	probably null	Het
Pnp	T	A	14: 50,950,720		probably null	Het
Ptpn18	T	C	1: 34,463,130	S76P	probably benign	Het
Qtrt2	A	T	16: 43,863,197	L304Q	probably damaging	Het
Rad51ap2	A	T	12: 11,457,400	E441V	possibly damaging	Het
Ranbp2	T	A	10: 58,477,889	V1477E	probably benign	Het
Repin1	C	T	6: 48,597,433	T432I	possibly damaging	Het
Rest	G	A	5: 77,282,511	G926R	probably benign	Het
Rnft1	T	A	11: 86,486,690	F143L	possibly damaging	Het
Sema3e	A	T	5: 14,232,094	I415L	probably benign	Het
Slc10a1	T	A	12: 80,967,595	N117I	probably damaging	Het
Slc25a23	G	A	17: 57,059,709		probably benign	Het
Slc2a2	T	C	3: 28,713,802	S160P	possibly damaging	Het
Srrd	A	G	5: 112,338,456	V178A	possibly damaging	Het
Tmigd3	G	T	3: 105,921,961	G198C	probably benign	Het
Trbv29	G	A	6: 41,271,405	M1I	probably null	Het
Tril	A	G	6: 53,819,584	S218P	probably damaging	Het
Trip11	T	C	12: 101,862,598	K1749R	probably benign	Het
Ttc25	G	T	11: 100,566,926	E452*	probably null	Het
Ttn	A	G	2: 76,830,651	V12011A		Het
Ubr4	T	G	4: 139,410,518	F1093V	probably benign	Het
Urb2	C	A	8: 124,028,403	A283E	probably benign	Het
Usp43	T	A	11: 67,898,881		probably benign	Het
Vmn1r28	A	T	6: 58,265,684	I171F	probably benign	Het
Vps33a	G	A	5: 123,533,899	R469W	probably damaging	Het
Zfp202	G	A	9: 40,211,757	R605Q	probably damaging	Het
Zpbp2	A	T	11: 98,554,620	H158L	probably benign	Het

Other mutations in Gm19410

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
BB009:Gm19410	UTSW	8	35795599	missense	probably damaging	0.98
BB019:Gm19410	UTSW	8	35795599	missense	probably damaging	0.98
R0046:Gm19410	UTSW	8	35802645	missense	probably benign	0.31
R6026:Gm19410	UTSW	8	35812426	missense	probably benign	0.03
R6039:Gm19410	UTSW	8	35809364	missense	probably benign	0.44
R6039:Gm19410	UTSW	8	35809364	missense	probably benign	0.44
R6185:Gm19410	UTSW	8	35807510	missense	possibly damaging	0.87
R6239:Gm19410	UTSW	8	35778764	missense	probably damaging	0.98
R6303:Gm19410	UTSW	8	35807560	missense	possibly damaging	0.96
R6377:Gm19410	UTSW	8	35803582	nonsense	probably null
R6545:Gm19410	UTSW	8	35790498	missense	possibly damaging	0.93
R6700:Gm19410	UTSW	8	35807510	missense	possibly damaging	0.87
R6720:Gm19410	UTSW	8	35807576	missense	probably benign	0.12
R6795:Gm19410	UTSW	8	35795522	missense	probably damaging	0.98
R6808:Gm19410	UTSW	8	35772579	missense	probably damaging	0.99
R6810:Gm19410	UTSW	8	35772579	missense	probably damaging	0.99
R6811:Gm19410	UTSW	8	35772579	missense	probably damaging	0.99
R6966:Gm19410	UTSW	8	35817973	missense	possibly damaging	0.84
R7264:Gm19410	UTSW	8	35785766	missense	probably benign	0.01
R7267:Gm19410	UTSW	8	35814843	missense	possibly damaging	0.80
R7355:Gm19410	UTSW	8	35807072	missense	probably benign	0.00
R7423:Gm19410	UTSW	8	35804607	missense	probably benign	0.28
R7494:Gm19410	UTSW	8	35795530	missense	probably damaging	0.99
R7516:Gm19410	UTSW	8	35796279	missense	probably benign	0.30
R7517:Gm19410	UTSW	8	35773618	missense	possibly damaging	0.45
R7526:Gm19410	UTSW	8	35790612	missense	probably damaging	0.98
R7527:Gm19410	UTSW	8	35802232	missense	probably damaging	0.99
R7545:Gm19410	UTSW	8	35802625	missense	probably damaging	0.99
R7549:Gm19410	UTSW	8	35799346	missense	probably benign	0.20
R7564:Gm19410	UTSW	8	35806997	missense	probably benign	0.00
R7615:Gm19410	UTSW	8	35796359	missense	probably damaging	1.00
R7622:Gm19410	UTSW	8	35810347	missense	possibly damaging	0.91
R7655:Gm19410	UTSW	8	35809099	missense	probably benign
R7656:Gm19410	UTSW	8	35809099	missense	probably benign
R7703:Gm19410	UTSW	8	35799385	missense	probably damaging	0.98
R7750:Gm19410	UTSW	8	35807498	missense	possibly damaging	0.68
R7760:Gm19410	UTSW	8	35802337	missense	probably damaging	0.99
R7837:Gm19410	UTSW	8	35808980	missense	possibly damaging	0.91
R7932:Gm19410	UTSW	8	35795599	missense	probably damaging	0.98
R7942:Gm19410	UTSW	8	35771786	missense	probably damaging	0.98
R7970:Gm19410	UTSW	8	35815647	missense	probably benign	0.00
R8088:Gm19410	UTSW	8	35806841	missense	probably benign	0.45
R8228:Gm19410	UTSW	8	35785838	missense	possibly damaging	0.53
R8382:Gm19410	UTSW	8	35809148	missense	probably damaging	0.99
R8757:Gm19410	UTSW	8	35808965	missense	possibly damaging	0.83
R9010:Gm19410	UTSW	8	35814857	missense	probably benign	0.02
R9060:Gm19410	UTSW	8	35802326	missense	probably damaging	1.00
R9088:Gm19410	UTSW	8	35773612	missense	probably damaging	1.00
R9104:Gm19410	UTSW	8	35780467	missense	probably damaging	0.99
R9186:Gm19410	UTSW	8	35815475	missense	possibly damaging	0.90
R9290:Gm19410	UTSW	8	35802232	missense	probably damaging	0.99
R9334:Gm19410	UTSW	8	35803568	nonsense	probably null
R9398:Gm19410	UTSW	8	35805202	missense	probably benign	0.00
R9439:Gm19410	UTSW	8	35781656	missense	probably damaging	0.96
R9445:Gm19410	UTSW	8	35772498	missense	possibly damaging	0.75
R9511:Gm19410	UTSW	8	35790694	missense	probably damaging	0.99
R9520:Gm19410	UTSW	8	35795483	missense	probably benign	0.15
R9523:Gm19410	UTSW	8	35790454	missense	probably benign	0.01
R9669:Gm19410	UTSW	8	35780339	missense	possibly damaging	0.45
R9711:Gm19410	UTSW	8	35812339	missense	possibly damaging	0.85
R9728:Gm19410	UTSW	8	35780440	missense	possibly damaging	0.95
R9759:Gm19410	UTSW	8	35785784	missense	possibly damaging	0.53
Z1176:Gm19410	UTSW	8	35792611	missense	possibly damaging	0.79
Z1177:Gm19410	UTSW	8	35808965	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- TCCAGTCAACTGATGATCTCTG -3'
(R):5'- TACAAGCTGTGGGTGAGCAG -3'

Sequencing Primer
(F):5'- GTCAACTGATGATCTCTGACAAGCTC -3'
(R):5'- AGTAATGGCCCCTGTCCCTAAG -3'

Posted On

2021-07-15