Incidental Mutation 'R8879:Frem3'
ID 676769
Institutional Source Beutler Lab
Gene Symbol Frem3
Ensembl Gene ENSMUSG00000042353
Gene Name Fras1 related extracellular matrix protein 3
Synonyms LOC333315
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock # R8879 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 80611080-80695356 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 80613148 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 690 (D690V)
Ref Sequence ENSEMBL: ENSMUSP00000038015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039695]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000039695
AA Change: D690V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038015
Gene: ENSMUSG00000042353
AA Change: D690V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cadherin_3 369 515 9.5e-31 PFAM
Pfam:Cadherin_3 495 596 9.4e-20 PFAM
Pfam:Cadherin_3 637 786 4.2e-20 PFAM
Pfam:Cadherin_3 788 913 5.5e-23 PFAM
Pfam:Cadherin_3 998 1163 1.8e-20 PFAM
Pfam:Cadherin_3 1129 1254 1.3e-19 PFAM
Pfam:Cadherin_3 1250 1395 9.5e-34 PFAM
Pfam:Cadherin_3 1397 1508 2.7e-21 PFAM
Pfam:Cadherin_3 1493 1617 1.2e-27 PFAM
Pfam:Cadherin_3 1622 1748 4.8e-17 PFAM
Calx_beta 1754 1853 1.45e-7 SMART
Calx_beta 1866 1977 3.35e-12 SMART
Calx_beta 1991 2098 1.61e-5 SMART
Meta Mutation Damage Score 0.6725 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The protein belongs to the family of FRAS1/FREM extracellular matrix proteins and may play a role cell adhesion. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C T 15: 58,022,509 V326M probably damaging Het
Adap2 T A 11: 80,156,959 H80Q probably benign Het
Ang4 T C 14: 51,764,486 T2A probably benign Het
Arf2 T C 11: 103,979,759 probably null Het
B3gnt4 A G 5: 123,511,148 D192G probably damaging Het
BC034090 T C 1: 155,226,357 I54V probably benign Het
Catsper3 A G 13: 55,804,895 T202A probably benign Het
Cenpe T A 3: 135,260,101 D2113E probably damaging Het
Clasp2 T C 9: 113,773,705 V191A probably benign Het
Col5a1 G T 2: 28,014,158 A1356S unknown Het
Cuzd1 A G 7: 131,308,848 S573P probably damaging Het
Cyp1a2 C A 9: 57,681,885 M215I possibly damaging Het
Dcaf17 T A 2: 71,063,402 I122K possibly damaging Het
Dhcr24 A G 4: 106,573,809 I232V probably benign Het
Dnah10 A G 5: 124,818,117 E3570G probably damaging Het
Dnaja4 A T 9: 54,714,704 probably benign Het
Ehd1 A G 19: 6,298,324 D444G probably damaging Het
Ehmt1 T A 2: 24,836,476 M766L possibly damaging Het
Eno4 A G 19: 58,970,722 I613M probably benign Het
Exoc3l A T 8: 105,290,549 M602K Het
Fam107a C T 14: 8,301,352 probably null Het
Gm11639 T C 11: 104,690,955 I41T probably benign Het
Gm19410 A T 8: 35,771,868 D97V probably damaging Het
Grik5 T A 7: 25,023,064 D540V possibly damaging Het
Hint1 T A 11: 54,869,943 D69E probably benign Het
Krt13 T C 11: 100,119,385 T257A probably benign Het
Lpin2 T C 17: 71,242,754 L676P probably damaging Het
Lrguk A G 6: 34,029,683 E76G probably benign Het
Lrrc8a A G 2: 30,256,298 M375V probably benign Het
Lrrtm3 T C 10: 64,089,238 Q50R possibly damaging Het
Mmrn1 T A 6: 60,976,529 L598Q probably damaging Het
Mrs2 A G 13: 25,001,784 I135T probably damaging Het
Neb T C 2: 52,235,580 D475G Het
Notch2 A G 3: 98,135,599 S1427G possibly damaging Het
Olfr118 C A 17: 37,672,411 Y129* probably null Het
Olfr682-ps1 A G 7: 105,126,686 V195A probably benign Het
Olfr694 A T 7: 106,689,089 I214N probably damaging Het
Olfr816 A G 10: 129,911,862 C139R probably damaging Het
Olfr952 A C 9: 39,426,219 V284G possibly damaging Het
Opcml T C 9: 28,902,151 F246S probably damaging Het
Pdzd2 C A 15: 12,402,319 V729F probably damaging Het
Pias2 C T 18: 77,146,768 Q565* probably null Het
Pnp T A 14: 50,950,720 probably null Het
Ptpn18 T C 1: 34,463,130 S76P probably benign Het
Qtrt2 A T 16: 43,863,197 L304Q probably damaging Het
Rad51ap2 A T 12: 11,457,400 E441V possibly damaging Het
Ranbp2 T A 10: 58,477,889 V1477E probably benign Het
Repin1 C T 6: 48,597,433 T432I possibly damaging Het
Rest G A 5: 77,282,511 G926R probably benign Het
Rnft1 T A 11: 86,486,690 F143L possibly damaging Het
Sema3e A T 5: 14,232,094 I415L probably benign Het
Slc10a1 T A 12: 80,967,595 N117I probably damaging Het
Slc25a23 G A 17: 57,059,709 probably benign Het
Slc2a2 T C 3: 28,713,802 S160P possibly damaging Het
Srrd A G 5: 112,338,456 V178A possibly damaging Het
Tmigd3 G T 3: 105,921,961 G198C probably benign Het
Trbv29 G A 6: 41,271,405 M1I probably null Het
Tril A G 6: 53,819,584 S218P probably damaging Het
Trip11 T C 12: 101,862,598 K1749R probably benign Het
Ttc25 G T 11: 100,566,926 E452* probably null Het
Ttn A G 2: 76,830,651 V12011A Het
Ubr4 T G 4: 139,410,518 F1093V probably benign Het
Urb2 C A 8: 124,028,403 A283E probably benign Het
Usp43 T A 11: 67,898,881 probably benign Het
Vmn1r28 A T 6: 58,265,684 I171F probably benign Het
Vps33a G A 5: 123,533,899 R469W probably damaging Het
Zfp202 G A 9: 40,211,757 R605Q probably damaging Het
Zpbp2 A T 11: 98,554,620 H158L probably benign Het
Other mutations in Frem3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Frem3 APN 8 80668810 missense possibly damaging 0.75
IGL01019:Frem3 APN 8 80615134 missense probably benign 0.02
IGL01470:Frem3 APN 8 80614315 missense probably damaging 1.00
IGL01609:Frem3 APN 8 80612704 missense probably benign 0.00
IGL01622:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01623:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01751:Frem3 APN 8 80615743 missense probably benign 0.33
IGL02037:Frem3 APN 8 80611489 missense probably benign 0.31
IGL02039:Frem3 APN 8 80612971 missense probably damaging 1.00
IGL02084:Frem3 APN 8 80612443 missense possibly damaging 0.95
IGL02124:Frem3 APN 8 80613094 missense probably damaging 0.99
IGL02140:Frem3 APN 8 80614107 missense possibly damaging 0.84
IGL02836:Frem3 APN 8 80614381 missense probably benign
IGL03090:Frem3 APN 8 80618229 missense probably benign 0.01
IGL03102:Frem3 APN 8 80613032 missense possibly damaging 0.92
IGL03116:Frem3 APN 8 80612806 missense possibly damaging 0.84
IGL03165:Frem3 APN 8 80612529 missense probably benign 0.26
IGL03224:Frem3 APN 8 80613463 missense probably damaging 1.00
IGL03401:Frem3 APN 8 80614541 missense probably damaging 1.00
IGL03403:Frem3 APN 8 80611090 missense probably benign 0.04
FR4340:Frem3 UTSW 8 80615241 small insertion probably benign
FR4976:Frem3 UTSW 8 80615241 small insertion probably benign
IGL02991:Frem3 UTSW 8 80668882 missense probably damaging 1.00
IGL03052:Frem3 UTSW 8 80614530 missense probably damaging 1.00
R0089:Frem3 UTSW 8 80615878 missense possibly damaging 0.94
R0647:Frem3 UTSW 8 80615185 missense probably damaging 1.00
R0690:Frem3 UTSW 8 80613952 missense possibly damaging 0.84
R0766:Frem3 UTSW 8 80615322 missense probably benign
R0834:Frem3 UTSW 8 80687008 missense probably damaging 1.00
R0909:Frem3 UTSW 8 80663406 missense probably benign 0.45
R1033:Frem3 UTSW 8 80695157 missense probably benign 0.00
R1144:Frem3 UTSW 8 80611884 missense probably benign 0.01
R1312:Frem3 UTSW 8 80615322 missense probably benign
R1330:Frem3 UTSW 8 80668839 missense probably damaging 0.99
R1355:Frem3 UTSW 8 80690702 missense probably damaging 1.00
R1390:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R1413:Frem3 UTSW 8 80668801 missense probably benign
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1503:Frem3 UTSW 8 80687018 missense probably damaging 0.99
R1538:Frem3 UTSW 8 80612710 missense probably damaging 1.00
R1538:Frem3 UTSW 8 80613135 missense probably benign 0.00
R1612:Frem3 UTSW 8 80614861 missense probably damaging 1.00
R1793:Frem3 UTSW 8 80613112 missense probably benign 0.03
R1872:Frem3 UTSW 8 80612576 missense probably damaging 1.00
R1879:Frem3 UTSW 8 80611938 nonsense probably null
R1886:Frem3 UTSW 8 80613885 missense probably benign 0.00
R1933:Frem3 UTSW 8 80612890 missense probably benign 0.00
R2027:Frem3 UTSW 8 80695337 missense possibly damaging 0.75
R2040:Frem3 UTSW 8 80615826 missense possibly damaging 0.92
R2050:Frem3 UTSW 8 80614891 missense probably damaging 1.00
R2079:Frem3 UTSW 8 80615103 missense probably benign 0.03
R2099:Frem3 UTSW 8 80615859 missense probably benign 0.06
R2120:Frem3 UTSW 8 80615457 missense probably benign 0.20
R2842:Frem3 UTSW 8 80669349 splice site probably null
R2845:Frem3 UTSW 8 80613220 missense probably damaging 1.00
R3015:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R3442:Frem3 UTSW 8 80613040 missense probably damaging 1.00
R3724:Frem3 UTSW 8 80615271 missense probably benign 0.06
R3730:Frem3 UTSW 8 80615916 missense probably damaging 0.99
R3939:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3940:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3941:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R4089:Frem3 UTSW 8 80615173 missense probably damaging 1.00
R4282:Frem3 UTSW 8 80614141 missense probably benign 0.00
R4437:Frem3 UTSW 8 80612607 missense probably benign 0.30
R4480:Frem3 UTSW 8 80611357 missense probably benign 0.10
R4575:Frem3 UTSW 8 80616075 missense probably benign 0.17
R4583:Frem3 UTSW 8 80613514 missense probably benign 0.03
R4620:Frem3 UTSW 8 80668957 missense possibly damaging 0.82
R4621:Frem3 UTSW 8 80669191 splice site probably null
R4644:Frem3 UTSW 8 80613727 missense probably benign 0.33
R4667:Frem3 UTSW 8 80663420 missense probably damaging 0.97
R4748:Frem3 UTSW 8 80611459 missense probably damaging 1.00
R4823:Frem3 UTSW 8 80613958 missense probably benign 0.25
R4836:Frem3 UTSW 8 80663397 missense probably damaging 0.99
R4867:Frem3 UTSW 8 80613283 missense probably damaging 1.00
R4921:Frem3 UTSW 8 80613136 missense possibly damaging 0.83
R5030:Frem3 UTSW 8 80613247 missense possibly damaging 0.89
R5035:Frem3 UTSW 8 80615914 missense probably damaging 0.97
R5172:Frem3 UTSW 8 80612566 missense probably benign 0.44
R5289:Frem3 UTSW 8 80612319 missense probably benign 0.00
R5492:Frem3 UTSW 8 80612677 missense probably damaging 1.00
R5655:Frem3 UTSW 8 80612694 missense probably benign 0.00
R5685:Frem3 UTSW 8 80695303 missense probably damaging 1.00
R5723:Frem3 UTSW 8 80613397 missense probably benign 0.02
R5743:Frem3 UTSW 8 80615778 missense probably damaging 0.98
R5889:Frem3 UTSW 8 80614288 missense probably damaging 1.00
R6048:Frem3 UTSW 8 80613433 missense probably benign 0.03
R6057:Frem3 UTSW 8 80615587 missense probably damaging 0.99
R6137:Frem3 UTSW 8 80615047 missense probably benign
R6264:Frem3 UTSW 8 80615203 missense probably damaging 1.00
R6339:Frem3 UTSW 8 80613015 missense possibly damaging 0.84
R6418:Frem3 UTSW 8 80611152 missense probably benign 0.08
R6680:Frem3 UTSW 8 80669320 missense probably damaging 1.00
R6773:Frem3 UTSW 8 80611815 missense probably damaging 1.00
R6838:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R6928:Frem3 UTSW 8 80611282 missense possibly damaging 0.48
R6939:Frem3 UTSW 8 80615145 missense probably benign 0.23
R6995:Frem3 UTSW 8 80612579 missense probably damaging 0.98
R7112:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7155:Frem3 UTSW 8 80616039 missense probably benign 0.01
R7235:Frem3 UTSW 8 80690725 missense probably benign 0.00
R7282:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7403:Frem3 UTSW 8 80616145 missense probably damaging 1.00
R7422:Frem3 UTSW 8 80615763 missense probably benign 0.00
R7485:Frem3 UTSW 8 80613336 missense probably damaging 1.00
R7516:Frem3 UTSW 8 80612083 missense probably damaging 0.99
R7858:Frem3 UTSW 8 80611721 nonsense probably null
R7976:Frem3 UTSW 8 80611602 nonsense probably null
R8171:Frem3 UTSW 8 80615240 missense probably damaging 1.00
R8185:Frem3 UTSW 8 80612304 nonsense probably null
R8306:Frem3 UTSW 8 80612211 missense possibly damaging 0.95
R8478:Frem3 UTSW 8 80611558 missense probably damaging 1.00
R8518:Frem3 UTSW 8 80612595 missense probably damaging 1.00
R8794:Frem3 UTSW 8 80612278 missense probably damaging 1.00
R8794:Frem3 UTSW 8 80616222 missense probably benign 0.02
R8806:Frem3 UTSW 8 80663435 missense probably benign 0.30
R8833:Frem3 UTSW 8 80612772 missense probably benign 0.29
R8897:Frem3 UTSW 8 80612790 missense probably damaging 1.00
R8983:Frem3 UTSW 8 80669246 missense probably damaging 1.00
R9207:Frem3 UTSW 8 80613442 missense possibly damaging 0.73
R9277:Frem3 UTSW 8 80690773 missense probably damaging 0.96
RF030:Frem3 UTSW 8 80615238 small insertion probably benign
RF034:Frem3 UTSW 8 80615238 small insertion probably benign
RF042:Frem3 UTSW 8 80615238 small insertion probably benign
X0024:Frem3 UTSW 8 80613081 missense possibly damaging 0.76
X0027:Frem3 UTSW 8 80612388 nonsense probably null
Z1088:Frem3 UTSW 8 80615426 missense probably benign 0.04
Z1176:Frem3 UTSW 8 80611503 missense probably damaging 0.99
Z1176:Frem3 UTSW 8 80615431 missense probably benign 0.03
Z1177:Frem3 UTSW 8 80616129 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AGGGCCTTTATGAGACGGTAG -3'
(R):5'- CCTGGTGAATCAGTGAGCAC -3'

Sequencing Primer
(F):5'- CCTTTATGAGACGGTAGTGACTGAG -3'
(R):5'- GTGAATCAGTGAGCACGATCTCTC -3'
Posted On 2021-07-15