Mutagenetix > Incidental Mutation

Incidental Mutation 'R8879:Olfr952'

676773

Institutional Source

Beutler Lab

Gene Symbol

Olfr952

Ensembl Gene

ENSMUSG00000058856

Gene Name

olfactory receptor 952

Synonyms

MOR171-21, GA_x6K02T2PVTD-33124064-33123120

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R8879 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

39426093-39427148 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 39426219 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 284 (V284G)

Ref Sequence

ENSEMBL: ENSMUSP00000073558 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073895]

AlphaFold

Q8VFD7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000073895
AA Change: V284G

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000073558
Gene: ENSMUSG00000058856
AA Change: V284G

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	8.5e-42	PFAM
Pfam:7tm_1	41	294	3.2e-18	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130401M01Rik	C	T	15: 58,022,509	V326M	probably damaging	Het
Adap2	T	A	11: 80,156,959	H80Q	probably benign	Het
Ang4	T	C	14: 51,764,486	T2A	probably benign	Het
Arf2	T	C	11: 103,979,759		probably null	Het
B3gnt4	A	G	5: 123,511,148	D192G	probably damaging	Het
BC034090	T	C	1: 155,226,357	I54V	probably benign	Het
Catsper3	A	G	13: 55,804,895	T202A	probably benign	Het
Cenpe	T	A	3: 135,260,101	D2113E	probably damaging	Het
Clasp2	T	C	9: 113,773,705	V191A	probably benign	Het
Col5a1	G	T	2: 28,014,158	A1356S	unknown	Het
Cuzd1	A	G	7: 131,308,848	S573P	probably damaging	Het
Cyp1a2	C	A	9: 57,681,885	M215I	possibly damaging	Het
Dcaf17	T	A	2: 71,063,402	I122K	possibly damaging	Het
Dhcr24	A	G	4: 106,573,809	I232V	probably benign	Het
Dnah10	A	G	5: 124,818,117	E3570G	probably damaging	Het
Dnaja4	A	T	9: 54,714,704		probably benign	Het
Ehd1	A	G	19: 6,298,324	D444G	probably damaging	Het
Ehmt1	T	A	2: 24,836,476	M766L	possibly damaging	Het
Eno4	A	G	19: 58,970,722	I613M	probably benign	Het
Exoc3l	A	T	8: 105,290,549	M602K		Het
Fam107a	C	T	14: 8,301,352		probably null	Het
Frem3	A	T	8: 80,613,148	D690V	probably damaging	Het
Gm11639	T	C	11: 104,690,955	I41T	probably benign	Het
Gm19410	A	T	8: 35,771,868	D97V	probably damaging	Het
Grik5	T	A	7: 25,023,064	D540V	possibly damaging	Het
Hint1	T	A	11: 54,869,943	D69E	probably benign	Het
Krt13	T	C	11: 100,119,385	T257A	probably benign	Het
Lpin2	T	C	17: 71,242,754	L676P	probably damaging	Het
Lrguk	A	G	6: 34,029,683	E76G	probably benign	Het
Lrrc8a	A	G	2: 30,256,298	M375V	probably benign	Het
Lrrtm3	T	C	10: 64,089,238	Q50R	possibly damaging	Het
Mmrn1	T	A	6: 60,976,529	L598Q	probably damaging	Het
Mrs2	A	G	13: 25,001,784	I135T	probably damaging	Het
Neb	T	C	2: 52,235,580	D475G		Het
Notch2	A	G	3: 98,135,599	S1427G	possibly damaging	Het
Olfr118	C	A	17: 37,672,411	Y129*	probably null	Het
Olfr682-ps1	A	G	7: 105,126,686	V195A	probably benign	Het
Olfr694	A	T	7: 106,689,089	I214N	probably damaging	Het
Olfr816	A	G	10: 129,911,862	C139R	probably damaging	Het
Opcml	T	C	9: 28,902,151	F246S	probably damaging	Het
Pdzd2	C	A	15: 12,402,319	V729F	probably damaging	Het
Pias2	C	T	18: 77,146,768	Q565*	probably null	Het
Pnp	T	A	14: 50,950,720		probably null	Het
Ptpn18	T	C	1: 34,463,130	S76P	probably benign	Het
Qtrt2	A	T	16: 43,863,197	L304Q	probably damaging	Het
Rad51ap2	A	T	12: 11,457,400	E441V	possibly damaging	Het
Ranbp2	T	A	10: 58,477,889	V1477E	probably benign	Het
Repin1	C	T	6: 48,597,433	T432I	possibly damaging	Het
Rest	G	A	5: 77,282,511	G926R	probably benign	Het
Rnft1	T	A	11: 86,486,690	F143L	possibly damaging	Het
Sema3e	A	T	5: 14,232,094	I415L	probably benign	Het
Slc10a1	T	A	12: 80,967,595	N117I	probably damaging	Het
Slc25a23	G	A	17: 57,059,709		probably benign	Het
Slc2a2	T	C	3: 28,713,802	S160P	possibly damaging	Het
Srrd	A	G	5: 112,338,456	V178A	possibly damaging	Het
Tmigd3	G	T	3: 105,921,961	G198C	probably benign	Het
Trbv29	G	A	6: 41,271,405	M1I	probably null	Het
Tril	A	G	6: 53,819,584	S218P	probably damaging	Het
Trip11	T	C	12: 101,862,598	K1749R	probably benign	Het
Ttc25	G	T	11: 100,566,926	E452*	probably null	Het
Ttn	A	G	2: 76,830,651	V12011A		Het
Ubr4	T	G	4: 139,410,518	F1093V	probably benign	Het
Urb2	C	A	8: 124,028,403	A283E	probably benign	Het
Usp43	T	A	11: 67,898,881		probably benign	Het
Vmn1r28	A	T	6: 58,265,684	I171F	probably benign	Het
Vps33a	G	A	5: 123,533,899	R469W	probably damaging	Het
Zfp202	G	A	9: 40,211,757	R605Q	probably damaging	Het
Zpbp2	A	T	11: 98,554,620	H158L	probably benign	Het

Other mutations in Olfr952

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00976:Olfr952	APN	9	39426657	missense	probably benign	0.02
IGL01368:Olfr952	APN	9	39426180	missense	probably damaging	1.00
IGL01866:Olfr952	APN	9	39426729	missense	probably damaging	0.99
IGL01939:Olfr952	APN	9	39426338	missense	probably damaging	1.00
IGL03048:Olfr952	UTSW	9	39426769	missense	probably benign	0.00
R0069:Olfr952	UTSW	9	39426892	missense	probably damaging	0.98
R1460:Olfr952	UTSW	9	39426207	missense	probably benign	0.43
R1478:Olfr952	UTSW	9	39426592	missense	possibly damaging	0.91
R1737:Olfr952	UTSW	9	39426958	missense	probably damaging	0.99
R2112:Olfr952	UTSW	9	39426670	missense	probably benign	0.26
R2169:Olfr952	UTSW	9	39426358	missense	possibly damaging	0.95
R2225:Olfr952	UTSW	9	39426619	missense	probably benign	0.00
R3731:Olfr952	UTSW	9	39427069	start codon destroyed	probably benign	0.23
R3777:Olfr952	UTSW	9	39426605	missense	possibly damaging	0.75
R3802:Olfr952	UTSW	9	39426286	missense	probably damaging	1.00
R4600:Olfr952	UTSW	9	39426435	missense	probably benign	0.27
R4887:Olfr952	UTSW	9	39426235	missense	possibly damaging	0.80
R5215:Olfr952	UTSW	9	39426623	nonsense	probably null
R5813:Olfr952	UTSW	9	39426736	missense	probably damaging	1.00
R6140:Olfr952	UTSW	9	39426247	missense	possibly damaging	0.91
R6180:Olfr952	UTSW	9	39426712	missense	probably damaging	1.00
R6383:Olfr952	UTSW	9	39426234	missense	probably damaging	1.00
R6416:Olfr952	UTSW	9	39426891	missense	probably damaging	0.98
R6808:Olfr952	UTSW	9	39426540	missense	probably damaging	0.99
R7099:Olfr952	UTSW	9	39426303	missense	probably benign	0.01
R7826:Olfr952	UTSW	9	39426127	makesense	probably null
R8309:Olfr952	UTSW	9	39426670	missense	probably benign	0.40
R8870:Olfr952	UTSW	9	39426252	missense	probably damaging	0.97
R9084:Olfr952	UTSW	9	39426225	missense	probably damaging	1.00
R9209:Olfr952	UTSW	9	39426339	missense	probably damaging	0.99
R9435:Olfr952	UTSW	9	39426210	missense	probably benign
R9583:Olfr952	UTSW	9	39426555	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- TGGATATGCGTCTGAGAGTCCTC -3'
(R):5'- TTGCACATTAAATCCTCTGGGG -3'

Sequencing Primer
(F):5'- CGTCTGAGAGTCCTCTTATATTTTG -3'
(R):5'- CATTAAATCCTCTGGGGGCAGAGTC -3'

Posted On

2021-07-15