Incidental Mutation 'R8879:Zfp202'
ID 676774
Institutional Source Beutler Lab
Gene Symbol Zfp202
Ensembl Gene ENSMUSG00000025602
Gene Name zinc finger protein 202
Synonyms C130037E22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8879 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 40192316-40213604 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 40211757 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 605 (R605Q)
Ref Sequence ENSEMBL: ENSMUSP00000026693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026693] [ENSMUST00000168691] [ENSMUST00000168832]
AlphaFold Q8C879
Predicted Effect probably damaging
Transcript: ENSMUST00000026693
AA Change: R605Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026693
Gene: ENSMUSG00000025602
AA Change: R605Q

DomainStartEndE-ValueType
SCAN 42 154 1.19e-75 SMART
KRAB 237 297 1.7e-17 SMART
ZnF_C2H2 391 413 9.44e-2 SMART
ZnF_C2H2 419 441 6.42e-4 SMART
ZnF_C2H2 473 495 3.44e-4 SMART
ZnF_C2H2 501 523 1.47e-3 SMART
ZnF_C2H2 529 551 1.64e-1 SMART
ZnF_C2H2 557 579 3.11e-2 SMART
ZnF_C2H2 585 607 8.47e-4 SMART
ZnF_C2H2 613 635 3.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168691
SMART Domains Protein: ENSMUSP00000130163
Gene: ENSMUSG00000025602

DomainStartEndE-ValueType
SCAN 42 132 1.03e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168832
SMART Domains Protein: ENSMUSP00000132131
Gene: ENSMUSG00000025602

DomainStartEndE-ValueType
SCAN 42 154 1.19e-75 SMART
KRAB 237 277 5.32e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C T 15: 58,022,509 V326M probably damaging Het
Adap2 T A 11: 80,156,959 H80Q probably benign Het
Ang4 T C 14: 51,764,486 T2A probably benign Het
Arf2 T C 11: 103,979,759 probably null Het
B3gnt4 A G 5: 123,511,148 D192G probably damaging Het
BC034090 T C 1: 155,226,357 I54V probably benign Het
Catsper3 A G 13: 55,804,895 T202A probably benign Het
Cenpe T A 3: 135,260,101 D2113E probably damaging Het
Clasp2 T C 9: 113,773,705 V191A probably benign Het
Col5a1 G T 2: 28,014,158 A1356S unknown Het
Cuzd1 A G 7: 131,308,848 S573P probably damaging Het
Cyp1a2 C A 9: 57,681,885 M215I possibly damaging Het
Dcaf17 T A 2: 71,063,402 I122K possibly damaging Het
Dhcr24 A G 4: 106,573,809 I232V probably benign Het
Dnah10 A G 5: 124,818,117 E3570G probably damaging Het
Dnaja4 A T 9: 54,714,704 probably benign Het
Ehd1 A G 19: 6,298,324 D444G probably damaging Het
Ehmt1 T A 2: 24,836,476 M766L possibly damaging Het
Eno4 A G 19: 58,970,722 I613M probably benign Het
Exoc3l A T 8: 105,290,549 M602K Het
Fam107a C T 14: 8,301,352 probably null Het
Frem3 A T 8: 80,613,148 D690V probably damaging Het
Gm11639 T C 11: 104,690,955 I41T probably benign Het
Gm19410 A T 8: 35,771,868 D97V probably damaging Het
Grik5 T A 7: 25,023,064 D540V possibly damaging Het
Hint1 T A 11: 54,869,943 D69E probably benign Het
Krt13 T C 11: 100,119,385 T257A probably benign Het
Lpin2 T C 17: 71,242,754 L676P probably damaging Het
Lrguk A G 6: 34,029,683 E76G probably benign Het
Lrrc8a A G 2: 30,256,298 M375V probably benign Het
Lrrtm3 T C 10: 64,089,238 Q50R possibly damaging Het
Mmrn1 T A 6: 60,976,529 L598Q probably damaging Het
Mrs2 A G 13: 25,001,784 I135T probably damaging Het
Neb T C 2: 52,235,580 D475G Het
Notch2 A G 3: 98,135,599 S1427G possibly damaging Het
Olfr118 C A 17: 37,672,411 Y129* probably null Het
Olfr682-ps1 A G 7: 105,126,686 V195A probably benign Het
Olfr694 A T 7: 106,689,089 I214N probably damaging Het
Olfr816 A G 10: 129,911,862 C139R probably damaging Het
Olfr952 A C 9: 39,426,219 V284G possibly damaging Het
Opcml T C 9: 28,902,151 F246S probably damaging Het
Pdzd2 C A 15: 12,402,319 V729F probably damaging Het
Pias2 C T 18: 77,146,768 Q565* probably null Het
Pnp T A 14: 50,950,720 probably null Het
Ptpn18 T C 1: 34,463,130 S76P probably benign Het
Qtrt2 A T 16: 43,863,197 L304Q probably damaging Het
Rad51ap2 A T 12: 11,457,400 E441V possibly damaging Het
Ranbp2 T A 10: 58,477,889 V1477E probably benign Het
Repin1 C T 6: 48,597,433 T432I possibly damaging Het
Rest G A 5: 77,282,511 G926R probably benign Het
Rnft1 T A 11: 86,486,690 F143L possibly damaging Het
Sema3e A T 5: 14,232,094 I415L probably benign Het
Slc10a1 T A 12: 80,967,595 N117I probably damaging Het
Slc25a23 G A 17: 57,059,709 probably benign Het
Slc2a2 T C 3: 28,713,802 S160P possibly damaging Het
Srrd A G 5: 112,338,456 V178A possibly damaging Het
Tmigd3 G T 3: 105,921,961 G198C probably benign Het
Trbv29 G A 6: 41,271,405 M1I probably null Het
Tril A G 6: 53,819,584 S218P probably damaging Het
Trip11 T C 12: 101,862,598 K1749R probably benign Het
Ttc25 G T 11: 100,566,926 E452* probably null Het
Ttn A G 2: 76,830,651 V12011A Het
Ubr4 T G 4: 139,410,518 F1093V probably benign Het
Urb2 C A 8: 124,028,403 A283E probably benign Het
Usp43 T A 11: 67,898,881 probably benign Het
Vmn1r28 A T 6: 58,265,684 I171F probably benign Het
Vps33a G A 5: 123,533,899 R469W probably damaging Het
Zpbp2 A T 11: 98,554,620 H158L probably benign Het
Other mutations in Zfp202
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Zfp202 APN 9 40211043 missense probably benign 0.02
IGL01862:Zfp202 APN 9 40211828 missense probably benign 0.39
IGL03069:Zfp202 APN 9 40211399 missense probably damaging 1.00
R0028:Zfp202 UTSW 9 40211752 missense probably damaging 1.00
R0158:Zfp202 UTSW 9 40208916 nonsense probably null
R0278:Zfp202 UTSW 9 40208482 missense probably benign 0.15
R1132:Zfp202 UTSW 9 40211022 missense probably benign 0.00
R1404:Zfp202 UTSW 9 40211496 missense probably damaging 1.00
R1404:Zfp202 UTSW 9 40211496 missense probably damaging 1.00
R1764:Zfp202 UTSW 9 40210466 missense probably benign 0.00
R1928:Zfp202 UTSW 9 40209787 missense probably damaging 1.00
R2929:Zfp202 UTSW 9 40211688 missense possibly damaging 0.94
R3153:Zfp202 UTSW 9 40208438 missense probably benign 0.00
R3948:Zfp202 UTSW 9 40208425 missense probably benign 0.43
R4190:Zfp202 UTSW 9 40211337 missense probably benign 0.00
R4273:Zfp202 UTSW 9 40207494 nonsense probably null
R6181:Zfp202 UTSW 9 40207342 missense probably damaging 1.00
R6182:Zfp202 UTSW 9 40207342 missense probably damaging 1.00
R6816:Zfp202 UTSW 9 40211813 missense probably damaging 1.00
R6835:Zfp202 UTSW 9 40210235 splice site probably null
R7382:Zfp202 UTSW 9 40211505 missense probably damaging 1.00
R7493:Zfp202 UTSW 9 40207344 missense possibly damaging 0.57
R7542:Zfp202 UTSW 9 40211147 missense probably benign 0.12
R7689:Zfp202 UTSW 9 40210533 missense probably benign 0.02
R7832:Zfp202 UTSW 9 40210462 missense possibly damaging 0.92
R8084:Zfp202 UTSW 9 40211242 missense probably benign 0.19
R8349:Zfp202 UTSW 9 40207680 nonsense probably null
R8449:Zfp202 UTSW 9 40207680 nonsense probably null
R9135:Zfp202 UTSW 9 40208941 missense possibly damaging 0.85
R9411:Zfp202 UTSW 9 40207582 missense probably damaging 1.00
R9785:Zfp202 UTSW 9 40208937 missense probably benign 0.00
X0012:Zfp202 UTSW 9 40211184 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGGCGAGAACTTCAGTG -3'
(R):5'- TTCTCAGGTTGAACACAGAACC -3'

Sequencing Primer
(F):5'- CTTCAGTGAGCAGAAGCAGTATCTG -3'
(R):5'- AGAACCCATCCGTCTCAGTTGG -3'
Posted On 2021-07-15