Incidental Mutation 'R8879:Cyp1a2'
ID 676775
Institutional Source Beutler Lab
Gene Symbol Cyp1a2
Ensembl Gene ENSMUSG00000032310
Gene Name cytochrome P450, family 1, subfamily a, polypeptide 2
Synonyms aromatic compound inducible, CP12, P450-3
MMRRC Submission 068747-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.245) question?
Stock # R8879 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 57584220-57590938 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 57589168 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 215 (M215I)
Ref Sequence ENSEMBL: ENSMUSP00000034860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034860]
AlphaFold P00186
Predicted Effect possibly damaging
Transcript: ENSMUST00000034860
AA Change: M215I

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000034860
Gene: ENSMUSG00000032310
AA Change: M215I

DomainStartEndE-ValueType
Pfam:p450 41 504 1.7e-105 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The protein encoded by this gene localizes to the endoplasmic reticulum and its expression is induced by some polycyclic aromatic hydrocarbons (PAHs), some of which are found in cigarette smoke. The enzyme's endogenous substrate is unknown; however, it is able to metabolize some PAHs to carcinogenic intermediates. Other xenobiotic substrates for this enzyme include caffeine, aflatoxin B1, and acetaminophen. The transcript from this gene contains four Alu sequences flanked by direct repeats in the 3' untranslated region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display resitance to some signs of TCDD induced toxicity but do not display any gross abnormalities in the abscence of treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C T 15: 57,885,905 (GRCm39) V326M probably damaging Het
Adap2 T A 11: 80,047,785 (GRCm39) H80Q probably benign Het
Ang4 T C 14: 52,001,943 (GRCm39) T2A probably benign Het
Arf2 T C 11: 103,870,585 (GRCm39) probably null Het
B3gnt4 A G 5: 123,649,211 (GRCm39) D192G probably damaging Het
BC034090 T C 1: 155,102,103 (GRCm39) I54V probably benign Het
Catsper3 A G 13: 55,952,708 (GRCm39) T202A probably benign Het
Cenpe T A 3: 134,965,862 (GRCm39) D2113E probably damaging Het
Clasp2 T C 9: 113,602,773 (GRCm39) V191A probably benign Het
Col5a1 G T 2: 27,904,170 (GRCm39) A1356S unknown Het
Cuzd1 A G 7: 130,910,577 (GRCm39) S573P probably damaging Het
Dcaf17 T A 2: 70,893,746 (GRCm39) I122K possibly damaging Het
Dhcr24 A G 4: 106,431,006 (GRCm39) I232V probably benign Het
Dnah10 A G 5: 124,895,181 (GRCm39) E3570G probably damaging Het
Dnaja4 A T 9: 54,621,988 (GRCm39) probably benign Het
Efcab3 T C 11: 104,581,781 (GRCm39) I41T probably benign Het
Ehd1 A G 19: 6,348,354 (GRCm39) D444G probably damaging Het
Ehmt1 T A 2: 24,726,488 (GRCm39) M766L possibly damaging Het
Eno4 A G 19: 58,959,154 (GRCm39) I613M probably benign Het
Exoc3l A T 8: 106,017,181 (GRCm39) M602K Het
Fam107a C T 14: 8,301,352 (GRCm38) probably null Het
Frem3 A T 8: 81,339,777 (GRCm39) D690V probably damaging Het
Gm19410 A T 8: 36,239,022 (GRCm39) D97V probably damaging Het
Grik5 T A 7: 24,722,489 (GRCm39) D540V possibly damaging Het
Hint1 T A 11: 54,760,769 (GRCm39) D69E probably benign Het
Krt13 T C 11: 100,010,211 (GRCm39) T257A probably benign Het
Lpin2 T C 17: 71,549,749 (GRCm39) L676P probably damaging Het
Lrguk A G 6: 34,006,618 (GRCm39) E76G probably benign Het
Lrrc8a A G 2: 30,146,310 (GRCm39) M375V probably benign Het
Lrrtm3 T C 10: 63,925,017 (GRCm39) Q50R possibly damaging Het
Mmrn1 T A 6: 60,953,513 (GRCm39) L598Q probably damaging Het
Mrs2 A G 13: 25,185,767 (GRCm39) I135T probably damaging Het
Neb T C 2: 52,125,592 (GRCm39) D475G Het
Notch2 A G 3: 98,042,915 (GRCm39) S1427G possibly damaging Het
Odad4 G T 11: 100,457,752 (GRCm39) E452* probably null Het
Opcml T C 9: 28,813,447 (GRCm39) F246S probably damaging Het
Or10al2 C A 17: 37,983,302 (GRCm39) Y129* probably null Het
Or2ag1b A T 7: 106,288,296 (GRCm39) I214N probably damaging Het
Or56a42-ps1 A G 7: 104,775,893 (GRCm39) V195A probably benign Het
Or6c69 A G 10: 129,747,731 (GRCm39) C139R probably damaging Het
Or8g33 A C 9: 39,337,515 (GRCm39) V284G possibly damaging Het
Pdzd2 C A 15: 12,402,405 (GRCm39) V729F probably damaging Het
Pias2 C T 18: 77,234,464 (GRCm39) Q565* probably null Het
Pnp T A 14: 51,188,177 (GRCm39) probably null Het
Ptpn18 T C 1: 34,502,211 (GRCm39) S76P probably benign Het
Qtrt2 A T 16: 43,683,560 (GRCm39) L304Q probably damaging Het
Rad51ap2 A T 12: 11,507,401 (GRCm39) E441V possibly damaging Het
Ranbp2 T A 10: 58,313,711 (GRCm39) V1477E probably benign Het
Repin1 C T 6: 48,574,367 (GRCm39) T432I possibly damaging Het
Rest G A 5: 77,430,358 (GRCm39) G926R probably benign Het
Rnft1 T A 11: 86,377,516 (GRCm39) F143L possibly damaging Het
Sema3e A T 5: 14,282,108 (GRCm39) I415L probably benign Het
Slc10a1 T A 12: 81,014,369 (GRCm39) N117I probably damaging Het
Slc25a23 G A 17: 57,366,709 (GRCm39) probably benign Het
Slc2a2 T C 3: 28,767,951 (GRCm39) S160P possibly damaging Het
Srrd A G 5: 112,486,322 (GRCm39) V178A possibly damaging Het
Tmigd3 G T 3: 105,829,277 (GRCm39) G198C probably benign Het
Trbv28 G A 6: 41,248,339 (GRCm39) M1I probably null Het
Tril A G 6: 53,796,569 (GRCm39) S218P probably damaging Het
Trip11 T C 12: 101,828,857 (GRCm39) K1749R probably benign Het
Ttn A G 2: 76,660,995 (GRCm39) V12011A Het
Ubr4 T G 4: 139,137,829 (GRCm39) F1093V probably benign Het
Urb2 C A 8: 124,755,142 (GRCm39) A283E probably benign Het
Usp43 T A 11: 67,789,707 (GRCm39) probably benign Het
Vmn1r28 A T 6: 58,242,669 (GRCm39) I171F probably benign Het
Vps33a G A 5: 123,671,962 (GRCm39) R469W probably damaging Het
Zfp202 G A 9: 40,123,053 (GRCm39) R605Q probably damaging Het
Zpbp2 A T 11: 98,445,446 (GRCm39) H158L probably benign Het
Other mutations in Cyp1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Cyp1a2 APN 9 57,589,352 (GRCm39) nonsense probably null
IGL01161:Cyp1a2 APN 9 57,587,176 (GRCm39) missense probably damaging 1.00
IGL01583:Cyp1a2 APN 9 57,589,655 (GRCm39) missense probably benign 0.31
IGL01726:Cyp1a2 APN 9 57,589,485 (GRCm39) missense possibly damaging 0.78
IGL01973:Cyp1a2 APN 9 57,589,678 (GRCm39) missense probably damaging 1.00
IGL02995:Cyp1a2 APN 9 57,584,511 (GRCm39) makesense probably null
IGL03349:Cyp1a2 APN 9 57,587,158 (GRCm39) missense possibly damaging 0.82
broadway UTSW 9 57,584,516 (GRCm39) nonsense probably null
PIT4515001:Cyp1a2 UTSW 9 57,589,242 (GRCm39) missense probably benign 0.14
R0025:Cyp1a2 UTSW 9 57,589,344 (GRCm39) missense probably damaging 1.00
R0389:Cyp1a2 UTSW 9 57,589,308 (GRCm39) missense probably benign 0.00
R0582:Cyp1a2 UTSW 9 57,587,529 (GRCm39) splice site probably benign
R0589:Cyp1a2 UTSW 9 57,586,345 (GRCm39) missense possibly damaging 0.95
R1239:Cyp1a2 UTSW 9 57,589,050 (GRCm39) missense probably benign 0.02
R1988:Cyp1a2 UTSW 9 57,589,569 (GRCm39) missense possibly damaging 0.90
R2156:Cyp1a2 UTSW 9 57,589,433 (GRCm39) missense probably damaging 1.00
R2173:Cyp1a2 UTSW 9 57,584,798 (GRCm39) missense probably damaging 1.00
R2423:Cyp1a2 UTSW 9 57,587,232 (GRCm39) missense probably damaging 0.99
R3944:Cyp1a2 UTSW 9 57,589,151 (GRCm39) missense probably benign
R5225:Cyp1a2 UTSW 9 57,584,516 (GRCm39) nonsense probably null
R5419:Cyp1a2 UTSW 9 57,589,794 (GRCm39) missense probably benign 0.17
R5471:Cyp1a2 UTSW 9 57,586,303 (GRCm39) missense probably damaging 0.96
R5816:Cyp1a2 UTSW 9 57,588,336 (GRCm39) missense probably benign
R6017:Cyp1a2 UTSW 9 57,588,313 (GRCm39) missense probably damaging 0.98
R6825:Cyp1a2 UTSW 9 57,584,543 (GRCm39) missense probably benign 0.01
R6931:Cyp1a2 UTSW 9 57,589,439 (GRCm39) missense probably benign 0.02
R7058:Cyp1a2 UTSW 9 57,584,525 (GRCm39) missense probably damaging 0.99
R7079:Cyp1a2 UTSW 9 57,589,161 (GRCm39) missense probably benign
R7081:Cyp1a2 UTSW 9 57,586,272 (GRCm39) missense possibly damaging 0.52
R7400:Cyp1a2 UTSW 9 57,589,223 (GRCm39) missense probably benign 0.37
R7672:Cyp1a2 UTSW 9 57,589,620 (GRCm39) missense probably benign 0.05
R8097:Cyp1a2 UTSW 9 57,586,836 (GRCm39) splice site probably null
R8926:Cyp1a2 UTSW 9 57,588,361 (GRCm39) missense probably benign 0.00
R9083:Cyp1a2 UTSW 9 57,587,572 (GRCm39) missense probably benign 0.01
R9206:Cyp1a2 UTSW 9 57,589,583 (GRCm39) missense probably damaging 1.00
R9208:Cyp1a2 UTSW 9 57,589,583 (GRCm39) missense probably damaging 1.00
R9784:Cyp1a2 UTSW 9 57,587,562 (GRCm39) missense probably benign 0.07
RF007:Cyp1a2 UTSW 9 57,589,253 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACTCACCTTGTTGAAGTCTTGG -3'
(R):5'- AGAGCTTCTCCATAGCCTCG -3'

Sequencing Primer
(F):5'- AAGTCTTGGTAGTGCTCCTGGAC -3'
(R):5'- GACGTCAGCATCCTCTTGC -3'
Posted On 2021-07-15