Mutagenetix > Incidental Mutation

Incidental Mutation 'R8879:Cyp1a2'

676775

Institutional Source

Beutler Lab

Gene Symbol

Cyp1a2

Ensembl Gene

ENSMUSG00000032310

Gene Name

cytochrome P450, family 1, subfamily a, polypeptide 2

Synonyms

CP12, aromatic compound inducible, P450-3

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.399) question?

Stock #

R8879 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

57676937-57683703 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 57681885 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 215 (M215I)

Ref Sequence

ENSEMBL: ENSMUSP00000034860 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034860]

AlphaFold

P00186

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034860
AA Change: M215I

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000034860
Gene: ENSMUSG00000032310
AA Change: M215I

Domain	Start	End	E-Value	Type
Pfam:p450	41	504	1.7e-105	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The protein encoded by this gene localizes to the endoplasmic reticulum and its expression is induced by some polycyclic aromatic hydrocarbons (PAHs), some of which are found in cigarette smoke. The enzyme's endogenous substrate is unknown; however, it is able to metabolize some PAHs to carcinogenic intermediates. Other xenobiotic substrates for this enzyme include caffeine, aflatoxin B1, and acetaminophen. The transcript from this gene contains four Alu sequences flanked by direct repeats in the 3' untranslated region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display resitance to some signs of TCDD induced toxicity but do not display any gross abnormalities in the abscence of treatment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130401M01Rik	C	T	15: 58,022,509	V326M	probably damaging	Het
Adap2	T	A	11: 80,156,959	H80Q	probably benign	Het
Ang4	T	C	14: 51,764,486	T2A	probably benign	Het
Arf2	T	C	11: 103,979,759		probably null	Het
B3gnt4	A	G	5: 123,511,148	D192G	probably damaging	Het
BC034090	T	C	1: 155,226,357	I54V	probably benign	Het
Catsper3	A	G	13: 55,804,895	T202A	probably benign	Het
Cenpe	T	A	3: 135,260,101	D2113E	probably damaging	Het
Clasp2	T	C	9: 113,773,705	V191A	probably benign	Het
Col5a1	G	T	2: 28,014,158	A1356S	unknown	Het
Cuzd1	A	G	7: 131,308,848	S573P	probably damaging	Het
Dcaf17	T	A	2: 71,063,402	I122K	possibly damaging	Het
Dhcr24	A	G	4: 106,573,809	I232V	probably benign	Het
Dnah10	A	G	5: 124,818,117	E3570G	probably damaging	Het
Dnaja4	A	T	9: 54,714,704		probably benign	Het
Ehd1	A	G	19: 6,298,324	D444G	probably damaging	Het
Ehmt1	T	A	2: 24,836,476	M766L	possibly damaging	Het
Eno4	A	G	19: 58,970,722	I613M	probably benign	Het
Exoc3l	A	T	8: 105,290,549	M602K		Het
Fam107a	C	T	14: 8,301,352		probably null	Het
Frem3	A	T	8: 80,613,148	D690V	probably damaging	Het
Gm11639	T	C	11: 104,690,955	I41T	probably benign	Het
Gm19410	A	T	8: 35,771,868	D97V	probably damaging	Het
Grik5	T	A	7: 25,023,064	D540V	possibly damaging	Het
Hint1	T	A	11: 54,869,943	D69E	probably benign	Het
Krt13	T	C	11: 100,119,385	T257A	probably benign	Het
Lpin2	T	C	17: 71,242,754	L676P	probably damaging	Het
Lrguk	A	G	6: 34,029,683	E76G	probably benign	Het
Lrrc8a	A	G	2: 30,256,298	M375V	probably benign	Het
Lrrtm3	T	C	10: 64,089,238	Q50R	possibly damaging	Het
Mmrn1	T	A	6: 60,976,529	L598Q	probably damaging	Het
Mrs2	A	G	13: 25,001,784	I135T	probably damaging	Het
Neb	T	C	2: 52,235,580	D475G		Het
Notch2	A	G	3: 98,135,599	S1427G	possibly damaging	Het
Olfr118	C	A	17: 37,672,411	Y129*	probably null	Het
Olfr682-ps1	A	G	7: 105,126,686	V195A	probably benign	Het
Olfr694	A	T	7: 106,689,089	I214N	probably damaging	Het
Olfr816	A	G	10: 129,911,862	C139R	probably damaging	Het
Olfr952	A	C	9: 39,426,219	V284G	possibly damaging	Het
Opcml	T	C	9: 28,902,151	F246S	probably damaging	Het
Pdzd2	C	A	15: 12,402,319	V729F	probably damaging	Het
Pias2	C	T	18: 77,146,768	Q565*	probably null	Het
Pnp	T	A	14: 50,950,720		probably null	Het
Ptpn18	T	C	1: 34,463,130	S76P	probably benign	Het
Qtrt2	A	T	16: 43,863,197	L304Q	probably damaging	Het
Rad51ap2	A	T	12: 11,457,400	E441V	possibly damaging	Het
Ranbp2	T	A	10: 58,477,889	V1477E	probably benign	Het
Repin1	C	T	6: 48,597,433	T432I	possibly damaging	Het
Rest	G	A	5: 77,282,511	G926R	probably benign	Het
Rnft1	T	A	11: 86,486,690	F143L	possibly damaging	Het
Sema3e	A	T	5: 14,232,094	I415L	probably benign	Het
Slc10a1	T	A	12: 80,967,595	N117I	probably damaging	Het
Slc25a23	G	A	17: 57,059,709		probably benign	Het
Slc2a2	T	C	3: 28,713,802	S160P	possibly damaging	Het
Srrd	A	G	5: 112,338,456	V178A	possibly damaging	Het
Tmigd3	G	T	3: 105,921,961	G198C	probably benign	Het
Trbv29	G	A	6: 41,271,405	M1I	probably null	Het
Tril	A	G	6: 53,819,584	S218P	probably damaging	Het
Trip11	T	C	12: 101,862,598	K1749R	probably benign	Het
Ttc25	G	T	11: 100,566,926	E452*	probably null	Het
Ttn	A	G	2: 76,830,651	V12011A		Het
Ubr4	T	G	4: 139,410,518	F1093V	probably benign	Het
Urb2	C	A	8: 124,028,403	A283E	probably benign	Het
Usp43	T	A	11: 67,898,881		probably benign	Het
Vmn1r28	A	T	6: 58,265,684	I171F	probably benign	Het
Vps33a	G	A	5: 123,533,899	R469W	probably damaging	Het
Zfp202	G	A	9: 40,211,757	R605Q	probably damaging	Het
Zpbp2	A	T	11: 98,554,620	H158L	probably benign	Het

Other mutations in Cyp1a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Cyp1a2	APN	9	57682069	nonsense	probably null
IGL01161:Cyp1a2	APN	9	57679893	missense	probably damaging	1.00
IGL01583:Cyp1a2	APN	9	57682372	missense	probably benign	0.31
IGL01726:Cyp1a2	APN	9	57682202	missense	possibly damaging	0.78
IGL01973:Cyp1a2	APN	9	57682395	missense	probably damaging	1.00
IGL02995:Cyp1a2	APN	9	57677228	makesense	probably null
IGL03349:Cyp1a2	APN	9	57679875	missense	possibly damaging	0.82
broadway	UTSW	9	57677233	nonsense	probably null
PIT4515001:Cyp1a2	UTSW	9	57681959	missense	probably benign	0.14
R0025:Cyp1a2	UTSW	9	57682061	missense	probably damaging	1.00
R0389:Cyp1a2	UTSW	9	57682025	missense	probably benign	0.00
R0582:Cyp1a2	UTSW	9	57680246	splice site	probably benign
R0589:Cyp1a2	UTSW	9	57679062	missense	possibly damaging	0.95
R1239:Cyp1a2	UTSW	9	57681767	missense	probably benign	0.02
R1988:Cyp1a2	UTSW	9	57682286	missense	possibly damaging	0.90
R2156:Cyp1a2	UTSW	9	57682150	missense	probably damaging	1.00
R2173:Cyp1a2	UTSW	9	57677515	missense	probably damaging	1.00
R2423:Cyp1a2	UTSW	9	57679949	missense	probably damaging	0.99
R3944:Cyp1a2	UTSW	9	57681868	missense	probably benign
R5225:Cyp1a2	UTSW	9	57677233	nonsense	probably null
R5419:Cyp1a2	UTSW	9	57682511	missense	probably benign	0.17
R5471:Cyp1a2	UTSW	9	57679020	missense	probably damaging	0.96
R5816:Cyp1a2	UTSW	9	57681053	missense	probably benign
R6017:Cyp1a2	UTSW	9	57681030	missense	probably damaging	0.98
R6825:Cyp1a2	UTSW	9	57677260	missense	probably benign	0.01
R6931:Cyp1a2	UTSW	9	57682156	missense	probably benign	0.02
R7058:Cyp1a2	UTSW	9	57677242	missense	probably damaging	0.99
R7079:Cyp1a2	UTSW	9	57681878	missense	probably benign
R7081:Cyp1a2	UTSW	9	57678989	missense	possibly damaging	0.52
R7400:Cyp1a2	UTSW	9	57681940	missense	probably benign	0.37
R7672:Cyp1a2	UTSW	9	57682337	missense	probably benign	0.05
R8097:Cyp1a2	UTSW	9	57679553	splice site	probably null
R8926:Cyp1a2	UTSW	9	57681078	missense	probably benign	0.00
R9083:Cyp1a2	UTSW	9	57680289	missense	probably benign	0.01
R9206:Cyp1a2	UTSW	9	57682300	missense	probably damaging	1.00
R9208:Cyp1a2	UTSW	9	57682300	missense	probably damaging	1.00
R9784:Cyp1a2	UTSW	9	57680279	missense	probably benign	0.07
RF007:Cyp1a2	UTSW	9	57681970	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGACTCACCTTGTTGAAGTCTTGG -3'
(R):5'- AGAGCTTCTCCATAGCCTCG -3'

Sequencing Primer
(F):5'- AAGTCTTGGTAGTGCTCCTGGAC -3'
(R):5'- GACGTCAGCATCCTCTTGC -3'

Posted On

2021-07-15