Mutagenetix > Incidental Mutation

Incidental Mutation 'R8879:Clasp2'

676776

Institutional Source

Beutler Lab

Gene Symbol

Clasp2

Ensembl Gene

ENSMUSG00000033392

Gene Name

CLIP associating protein 2

Synonyms

1500004F14Rik, CLASP2gamma, CLASP2beta, CLASP2alpha, CLASP2, 8030404L10Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8879 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

113741473-113919682 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 113773705 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 191 (V191A)

Ref Sequence

ENSEMBL: ENSMUSP00000150741 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000213663] [ENSMUST00000216817]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000213663
AA Change: V191A

Predicted Effect

probably benign
Transcript: ENSMUST00000216817
AA Change: V191A

PolyPhen 2 Score 0.386 (Sensitivity: 0.90; Specificity: 0.89)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (69/69)

MGI Phenotype

PHENOTYPE: Targeted deletion of this gene leads to impaired formation of stable microtubules in a wound healing assay, and results in a 2-fold reduction of directionally persistent migration in mutant embryonic fibroblasts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130401M01Rik	C	T	15: 58,022,509	V326M	probably damaging	Het
Adap2	T	A	11: 80,156,959	H80Q	probably benign	Het
Ang4	T	C	14: 51,764,486	T2A	probably benign	Het
Arf2	T	C	11: 103,979,759		probably null	Het
B3gnt4	A	G	5: 123,511,148	D192G	probably damaging	Het
BC034090	T	C	1: 155,226,357	I54V	probably benign	Het
Catsper3	A	G	13: 55,804,895	T202A	probably benign	Het
Cenpe	T	A	3: 135,260,101	D2113E	probably damaging	Het
Col5a1	G	T	2: 28,014,158	A1356S	unknown	Het
Cuzd1	A	G	7: 131,308,848	S573P	probably damaging	Het
Cyp1a2	C	A	9: 57,681,885	M215I	possibly damaging	Het
Dcaf17	T	A	2: 71,063,402	I122K	possibly damaging	Het
Dhcr24	A	G	4: 106,573,809	I232V	probably benign	Het
Dnah10	A	G	5: 124,818,117	E3570G	probably damaging	Het
Dnaja4	A	T	9: 54,714,704		probably benign	Het
Ehd1	A	G	19: 6,298,324	D444G	probably damaging	Het
Ehmt1	T	A	2: 24,836,476	M766L	possibly damaging	Het
Eno4	A	G	19: 58,970,722	I613M	probably benign	Het
Exoc3l	A	T	8: 105,290,549	M602K		Het
Fam107a	C	T	14: 8,301,352		probably null	Het
Frem3	A	T	8: 80,613,148	D690V	probably damaging	Het
Gm11639	T	C	11: 104,690,955	I41T	probably benign	Het
Gm19410	A	T	8: 35,771,868	D97V	probably damaging	Het
Grik5	T	A	7: 25,023,064	D540V	possibly damaging	Het
Hint1	T	A	11: 54,869,943	D69E	probably benign	Het
Krt13	T	C	11: 100,119,385	T257A	probably benign	Het
Lpin2	T	C	17: 71,242,754	L676P	probably damaging	Het
Lrguk	A	G	6: 34,029,683	E76G	probably benign	Het
Lrrc8a	A	G	2: 30,256,298	M375V	probably benign	Het
Lrrtm3	T	C	10: 64,089,238	Q50R	possibly damaging	Het
Mmrn1	T	A	6: 60,976,529	L598Q	probably damaging	Het
Mrs2	A	G	13: 25,001,784	I135T	probably damaging	Het
Neb	T	C	2: 52,235,580	D475G		Het
Notch2	A	G	3: 98,135,599	S1427G	possibly damaging	Het
Olfr118	C	A	17: 37,672,411	Y129*	probably null	Het
Olfr682-ps1	A	G	7: 105,126,686	V195A	probably benign	Het
Olfr694	A	T	7: 106,689,089	I214N	probably damaging	Het
Olfr816	A	G	10: 129,911,862	C139R	probably damaging	Het
Olfr952	A	C	9: 39,426,219	V284G	possibly damaging	Het
Opcml	T	C	9: 28,902,151	F246S	probably damaging	Het
Pdzd2	C	A	15: 12,402,319	V729F	probably damaging	Het
Pias2	C	T	18: 77,146,768	Q565*	probably null	Het
Pnp	T	A	14: 50,950,720		probably null	Het
Ptpn18	T	C	1: 34,463,130	S76P	probably benign	Het
Qtrt2	A	T	16: 43,863,197	L304Q	probably damaging	Het
Rad51ap2	A	T	12: 11,457,400	E441V	possibly damaging	Het
Ranbp2	T	A	10: 58,477,889	V1477E	probably benign	Het
Repin1	C	T	6: 48,597,433	T432I	possibly damaging	Het
Rest	G	A	5: 77,282,511	G926R	probably benign	Het
Rnft1	T	A	11: 86,486,690	F143L	possibly damaging	Het
Sema3e	A	T	5: 14,232,094	I415L	probably benign	Het
Slc10a1	T	A	12: 80,967,595	N117I	probably damaging	Het
Slc25a23	G	A	17: 57,059,709		probably benign	Het
Slc2a2	T	C	3: 28,713,802	S160P	possibly damaging	Het
Srrd	A	G	5: 112,338,456	V178A	possibly damaging	Het
Tmigd3	G	T	3: 105,921,961	G198C	probably benign	Het
Trbv29	G	A	6: 41,271,405	M1I	probably null	Het
Tril	A	G	6: 53,819,584	S218P	probably damaging	Het
Trip11	T	C	12: 101,862,598	K1749R	probably benign	Het
Ttc25	G	T	11: 100,566,926	E452*	probably null	Het
Ttn	A	G	2: 76,830,651	V12011A		Het
Ubr4	T	G	4: 139,410,518	F1093V	probably benign	Het
Urb2	C	A	8: 124,028,403	A283E	probably benign	Het
Usp43	T	A	11: 67,898,881		probably benign	Het
Vmn1r28	A	T	6: 58,265,684	I171F	probably benign	Het
Vps33a	G	A	5: 123,533,899	R469W	probably damaging	Het
Zfp202	G	A	9: 40,211,757	R605Q	probably damaging	Het
Zpbp2	A	T	11: 98,554,620	H158L	probably benign	Het

Other mutations in Clasp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00772:Clasp2	APN	9	113905992	splice site	probably benign
IGL00885:Clasp2	APN	9	113911416	missense	probably damaging	1.00
IGL01314:Clasp2	APN	9	113906127	missense	possibly damaging	0.89
IGL01344:Clasp2	APN	9	113813292	splice site	probably null
IGL01567:Clasp2	APN	9	113880096	missense	probably damaging	1.00
IGL02238:Clasp2	APN	9	113880020	missense	probably damaging	1.00
IGL02299:Clasp2	APN	9	113879989	missense	probably damaging	1.00
IGL02323:Clasp2	APN	9	113868726	splice site	probably benign
IGL02635:Clasp2	APN	9	113908842	missense	probably damaging	0.98
IGL02645:Clasp2	APN	9	113890061	missense	probably damaging	1.00
IGL02976:Clasp2	APN	9	113906136	missense	probably damaging	1.00
IGL03190:Clasp2	APN	9	113844140	nonsense	probably null
IGL03219:Clasp2	APN	9	113848477	splice site	probably benign
PIT4810001:Clasp2	UTSW	9	113906067	missense	probably damaging	1.00
R0067:Clasp2	UTSW	9	113860141	splice site	probably benign
R0067:Clasp2	UTSW	9	113860141	splice site	probably benign
R0421:Clasp2	UTSW	9	113854302	missense	probably benign	0.02
R0432:Clasp2	UTSW	9	113909419	missense	probably benign	0.00
R0458:Clasp2	UTSW	9	113906224	splice site	probably null
R0865:Clasp2	UTSW	9	113911500	missense	possibly damaging	0.57
R0972:Clasp2	UTSW	9	113847705	missense	possibly damaging	0.58
R1037:Clasp2	UTSW	9	113896634	splice site	probably benign
R1925:Clasp2	UTSW	9	113906197	missense	possibly damaging	0.88
R2015:Clasp2	UTSW	9	113911500	missense	possibly damaging	0.57
R2066:Clasp2	UTSW	9	113906157	missense	possibly damaging	0.86
R2330:Clasp2	UTSW	9	113876304	missense	probably damaging	1.00
R2568:Clasp2	UTSW	9	113878764	missense	probably benign
R3011:Clasp2	UTSW	9	113901513	missense	probably damaging	1.00
R3879:Clasp2	UTSW	9	113889961	missense	probably damaging	0.98
R3915:Clasp2	UTSW	9	113908737	missense	probably damaging	0.99
R3928:Clasp2	UTSW	9	113906105	missense	probably benign	0.28
R4323:Clasp2	UTSW	9	113889959	missense	possibly damaging	0.91
R4571:Clasp2	UTSW	9	113847721	missense	probably damaging	1.00
R4975:Clasp2	UTSW	9	113903916	missense	probably damaging	1.00
R5445:Clasp2	UTSW	9	113903946	missense	probably damaging	1.00
R5564:Clasp2	UTSW	9	113812768	critical splice donor site	probably null
R5697:Clasp2	UTSW	9	113860122	missense	probably benign	0.01
R5780:Clasp2	UTSW	9	113850152	missense	probably damaging	0.99
R5787:Clasp2	UTSW	9	113862242	missense	probably damaging	1.00
R6011:Clasp2	UTSW	9	113876247	missense	probably benign	0.07
R6026:Clasp2	UTSW	9	113911578	missense	probably benign	0.13
R6090:Clasp2	UTSW	9	113852735	missense	probably benign	0.06
R6262:Clasp2	UTSW	9	113876352	critical splice donor site	probably null
R6427:Clasp2	UTSW	9	113892444	missense	probably damaging	1.00
R6464:Clasp2	UTSW	9	113773717	missense	probably damaging	1.00
R6586:Clasp2	UTSW	9	113813264	missense	probably damaging	1.00
R6628:Clasp2	UTSW	9	113896720	missense	probably damaging	1.00
R6745:Clasp2	UTSW	9	113875270	nonsense	probably null
R7032:Clasp2	UTSW	9	113854323	missense	probably benign	0.04
R7165:Clasp2	UTSW	9	113786399	splice site	probably null
R7221:Clasp2	UTSW	9	113852757	missense	probably damaging	0.99
R7336:Clasp2	UTSW	9	113876353	splice site	probably null
R7583:Clasp2	UTSW	9	113908687	missense	probably benign	0.02
R7774:Clasp2	UTSW	9	113848736	splice site	probably null
R7895:Clasp2	UTSW	9	113903948	missense	probably benign	0.03
R8084:Clasp2	UTSW	9	113847755	missense	probably benign	0.16
R8109:Clasp2	UTSW	9	113911520	missense	probably damaging	1.00
R8171:Clasp2	UTSW	9	113903906	missense	possibly damaging	0.88
R8230:Clasp2	UTSW	9	113892414	missense	possibly damaging	0.73
R8810:Clasp2	UTSW	9	113899581	missense	probably damaging	1.00
R8888:Clasp2	UTSW	9	113903868	missense	possibly damaging	0.54
R8889:Clasp2	UTSW	9	113880183	missense	probably damaging	1.00
R8892:Clasp2	UTSW	9	113880183	missense	probably damaging	1.00
R8922:Clasp2	UTSW	9	113896660	nonsense	probably null
R9042:Clasp2	UTSW	9	113905997	missense	probably benign
R9195:Clasp2	UTSW	9	113841977	missense	probably benign	0.06
R9355:Clasp2	UTSW	9	113835241	missense	probably damaging	1.00
R9481:Clasp2	UTSW	9	113841601	missense	probably damaging	1.00
R9502:Clasp2	UTSW	9	113908798	missense	probably benign	0.01
R9523:Clasp2	UTSW	9	113876304	missense	probably damaging	0.98
R9525:Clasp2	UTSW	9	113911609	missense	probably damaging	1.00
R9653:Clasp2	UTSW	9	113841925	missense	probably benign	0.01
R9699:Clasp2	UTSW	9	113909546	critical splice donor site	probably null
R9738:Clasp2	UTSW	9	113761597	nonsense	probably null
R9775:Clasp2	UTSW	9	113896672	missense	probably benign
X0022:Clasp2	UTSW	9	113852672	missense	probably damaging	1.00
Z1177:Clasp2	UTSW	9	113770221	missense	probably damaging	1.00
Z1177:Clasp2	UTSW	9	113908795	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGCTAAGTCACTAGGGTCTTTAAAAC -3'
(R):5'- AAACTGGTTCCAGGAAACTCAG -3'

Sequencing Primer
(F):5'- ACTCTTTAAATGAGTTTTCTAGGGC -3'
(R):5'- AAACTGTTATGGACCCCTGG -3'

Posted On

2021-07-15