Incidental Mutation 'R8879:Olfr816'
ID 676779
Institutional Source Beutler Lab
Gene Symbol Olfr816
Ensembl Gene ENSMUSG00000063715
Gene Name olfactory receptor 816
Synonyms GA_x6K02T2PULF-11590830-11589892, MOR113-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock # R8879 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 129909163-129915597 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 129911862 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 139 (C139R)
Ref Sequence ENSEMBL: ENSMUSP00000149515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071605] [ENSMUST00000213438]
AlphaFold Q8VFU2
Predicted Effect probably damaging
Transcript: ENSMUST00000071605
AA Change: C139R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071534
Gene: ENSMUSG00000063715
AA Change: C139R

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 6.9e-50 PFAM
Pfam:7tm_1 39 288 1.2e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213438
AA Change: C139R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C T 15: 58,022,509 V326M probably damaging Het
Adap2 T A 11: 80,156,959 H80Q probably benign Het
Ang4 T C 14: 51,764,486 T2A probably benign Het
Arf2 T C 11: 103,979,759 probably null Het
B3gnt4 A G 5: 123,511,148 D192G probably damaging Het
BC034090 T C 1: 155,226,357 I54V probably benign Het
Catsper3 A G 13: 55,804,895 T202A probably benign Het
Cenpe T A 3: 135,260,101 D2113E probably damaging Het
Clasp2 T C 9: 113,773,705 V191A probably benign Het
Col5a1 G T 2: 28,014,158 A1356S unknown Het
Cuzd1 A G 7: 131,308,848 S573P probably damaging Het
Cyp1a2 C A 9: 57,681,885 M215I possibly damaging Het
Dcaf17 T A 2: 71,063,402 I122K possibly damaging Het
Dhcr24 A G 4: 106,573,809 I232V probably benign Het
Dnah10 A G 5: 124,818,117 E3570G probably damaging Het
Dnaja4 A T 9: 54,714,704 probably benign Het
Ehd1 A G 19: 6,298,324 D444G probably damaging Het
Ehmt1 T A 2: 24,836,476 M766L possibly damaging Het
Eno4 A G 19: 58,970,722 I613M probably benign Het
Exoc3l A T 8: 105,290,549 M602K Het
Fam107a C T 14: 8,301,352 probably null Het
Frem3 A T 8: 80,613,148 D690V probably damaging Het
Gm11639 T C 11: 104,690,955 I41T probably benign Het
Gm19410 A T 8: 35,771,868 D97V probably damaging Het
Grik5 T A 7: 25,023,064 D540V possibly damaging Het
Hint1 T A 11: 54,869,943 D69E probably benign Het
Krt13 T C 11: 100,119,385 T257A probably benign Het
Lpin2 T C 17: 71,242,754 L676P probably damaging Het
Lrguk A G 6: 34,029,683 E76G probably benign Het
Lrrc8a A G 2: 30,256,298 M375V probably benign Het
Lrrtm3 T C 10: 64,089,238 Q50R possibly damaging Het
Mmrn1 T A 6: 60,976,529 L598Q probably damaging Het
Mrs2 A G 13: 25,001,784 I135T probably damaging Het
Neb T C 2: 52,235,580 D475G Het
Notch2 A G 3: 98,135,599 S1427G possibly damaging Het
Olfr118 C A 17: 37,672,411 Y129* probably null Het
Olfr682-ps1 A G 7: 105,126,686 V195A probably benign Het
Olfr694 A T 7: 106,689,089 I214N probably damaging Het
Olfr952 A C 9: 39,426,219 V284G possibly damaging Het
Opcml T C 9: 28,902,151 F246S probably damaging Het
Pdzd2 C A 15: 12,402,319 V729F probably damaging Het
Pias2 C T 18: 77,146,768 Q565* probably null Het
Pnp T A 14: 50,950,720 probably null Het
Ptpn18 T C 1: 34,463,130 S76P probably benign Het
Qtrt2 A T 16: 43,863,197 L304Q probably damaging Het
Rad51ap2 A T 12: 11,457,400 E441V possibly damaging Het
Ranbp2 T A 10: 58,477,889 V1477E probably benign Het
Repin1 C T 6: 48,597,433 T432I possibly damaging Het
Rest G A 5: 77,282,511 G926R probably benign Het
Rnft1 T A 11: 86,486,690 F143L possibly damaging Het
Sema3e A T 5: 14,232,094 I415L probably benign Het
Slc10a1 T A 12: 80,967,595 N117I probably damaging Het
Slc25a23 G A 17: 57,059,709 probably benign Het
Slc2a2 T C 3: 28,713,802 S160P possibly damaging Het
Srrd A G 5: 112,338,456 V178A possibly damaging Het
Tmigd3 G T 3: 105,921,961 G198C probably benign Het
Trbv29 G A 6: 41,271,405 M1I probably null Het
Tril A G 6: 53,819,584 S218P probably damaging Het
Trip11 T C 12: 101,862,598 K1749R probably benign Het
Ttc25 G T 11: 100,566,926 E452* probably null Het
Ttn A G 2: 76,830,651 V12011A Het
Ubr4 T G 4: 139,410,518 F1093V probably benign Het
Urb2 C A 8: 124,028,403 A283E probably benign Het
Usp43 T A 11: 67,898,881 probably benign Het
Vmn1r28 A T 6: 58,265,684 I171F probably benign Het
Vps33a G A 5: 123,533,899 R469W probably damaging Het
Zfp202 G A 9: 40,211,757 R605Q probably damaging Het
Zpbp2 A T 11: 98,554,620 H158L probably benign Het
Other mutations in Olfr816
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Olfr816 APN 10 129912245 missense possibly damaging 0.89
IGL01650:Olfr816 APN 10 129911681 missense probably benign 0.00
IGL01766:Olfr816 APN 10 129911780 missense probably damaging 1.00
IGL02738:Olfr816 APN 10 129911331 utr 3 prime probably benign
IGL02824:Olfr816 APN 10 129911696 missense probably damaging 1.00
R0401:Olfr816 UTSW 10 129911916 missense probably benign 0.18
R0688:Olfr816 UTSW 10 129911883 missense probably damaging 0.99
R1589:Olfr816 UTSW 10 129911681 missense probably benign 0.00
R1744:Olfr816 UTSW 10 129911393 missense probably damaging 1.00
R2049:Olfr816 UTSW 10 129912167 missense probably benign 0.30
R3763:Olfr816 UTSW 10 129911445 missense probably damaging 1.00
R3952:Olfr816 UTSW 10 129911636 missense probably benign 0.00
R3971:Olfr816 UTSW 10 129911873 missense probably benign 0.01
R4557:Olfr816 UTSW 10 129911529 missense probably damaging 1.00
R5538:Olfr816 UTSW 10 129912002 missense probably benign 0.13
R6127:Olfr816 UTSW 10 129911415 missense probably damaging 1.00
R6227:Olfr816 UTSW 10 129911667 missense probably damaging 1.00
R6394:Olfr816 UTSW 10 129911920 missense probably damaging 1.00
R6707:Olfr816 UTSW 10 129911739 missense probably benign 0.02
R7257:Olfr816 UTSW 10 129912287 start gained probably benign
R7258:Olfr816 UTSW 10 129912287 start gained probably benign
R7260:Olfr816 UTSW 10 129912287 start gained probably benign
R7409:Olfr816 UTSW 10 129912251 missense possibly damaging 0.74
R7539:Olfr816 UTSW 10 129912063 missense probably damaging 1.00
R7782:Olfr816 UTSW 10 129911523 missense probably damaging 1.00
R7984:Olfr816 UTSW 10 129912072 missense probably benign 0.00
R9533:Olfr816 UTSW 10 129911535 missense probably benign 0.20
R9717:Olfr816 UTSW 10 129912179 missense probably damaging 1.00
X0019:Olfr816 UTSW 10 129912095 missense probably damaging 1.00
Z1191:Olfr816 UTSW 10 129911957 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGATCACCATTACCAGCGTGAG -3'
(R):5'- GTTACTATGGCAACTGGGGAC -3'

Sequencing Primer
(F):5'- CATTACCAGCGTGAGTAAGAGTGTC -3'
(R):5'- CTGGGGACAAAACCATTTCCTATG -3'
Posted On 2021-07-15