Incidental Mutation 'R8879:Or6c69'
ID 676779
Institutional Source Beutler Lab
Gene Symbol Or6c69
Ensembl Gene ENSMUSG00000063715
Gene Name olfactory receptor family 6 subfamily C member 69
Synonyms MOR113-1, Olfr816, GA_x6K02T2PULF-11590830-11589892
MMRRC Submission 068747-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.082) question?
Stock # R8879 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 129747207-129748145 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 129747731 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 139 (C139R)
Ref Sequence ENSEMBL: ENSMUSP00000149515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071605] [ENSMUST00000213438]
AlphaFold Q8VFU2
Predicted Effect probably damaging
Transcript: ENSMUST00000071605
AA Change: C139R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071534
Gene: ENSMUSG00000063715
AA Change: C139R

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 6.9e-50 PFAM
Pfam:7tm_1 39 288 1.2e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213438
AA Change: C139R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C T 15: 57,885,905 (GRCm39) V326M probably damaging Het
Adap2 T A 11: 80,047,785 (GRCm39) H80Q probably benign Het
Ang4 T C 14: 52,001,943 (GRCm39) T2A probably benign Het
Arf2 T C 11: 103,870,585 (GRCm39) probably null Het
B3gnt4 A G 5: 123,649,211 (GRCm39) D192G probably damaging Het
BC034090 T C 1: 155,102,103 (GRCm39) I54V probably benign Het
Catsper3 A G 13: 55,952,708 (GRCm39) T202A probably benign Het
Cenpe T A 3: 134,965,862 (GRCm39) D2113E probably damaging Het
Clasp2 T C 9: 113,602,773 (GRCm39) V191A probably benign Het
Col5a1 G T 2: 27,904,170 (GRCm39) A1356S unknown Het
Cuzd1 A G 7: 130,910,577 (GRCm39) S573P probably damaging Het
Cyp1a2 C A 9: 57,589,168 (GRCm39) M215I possibly damaging Het
Dcaf17 T A 2: 70,893,746 (GRCm39) I122K possibly damaging Het
Dhcr24 A G 4: 106,431,006 (GRCm39) I232V probably benign Het
Dnah10 A G 5: 124,895,181 (GRCm39) E3570G probably damaging Het
Dnaja4 A T 9: 54,621,988 (GRCm39) probably benign Het
Efcab3 T C 11: 104,581,781 (GRCm39) I41T probably benign Het
Ehd1 A G 19: 6,348,354 (GRCm39) D444G probably damaging Het
Ehmt1 T A 2: 24,726,488 (GRCm39) M766L possibly damaging Het
Eno4 A G 19: 58,959,154 (GRCm39) I613M probably benign Het
Exoc3l A T 8: 106,017,181 (GRCm39) M602K Het
Fam107a C T 14: 8,301,352 (GRCm38) probably null Het
Frem3 A T 8: 81,339,777 (GRCm39) D690V probably damaging Het
Gm19410 A T 8: 36,239,022 (GRCm39) D97V probably damaging Het
Grik5 T A 7: 24,722,489 (GRCm39) D540V possibly damaging Het
Hint1 T A 11: 54,760,769 (GRCm39) D69E probably benign Het
Krt13 T C 11: 100,010,211 (GRCm39) T257A probably benign Het
Lpin2 T C 17: 71,549,749 (GRCm39) L676P probably damaging Het
Lrguk A G 6: 34,006,618 (GRCm39) E76G probably benign Het
Lrrc8a A G 2: 30,146,310 (GRCm39) M375V probably benign Het
Lrrtm3 T C 10: 63,925,017 (GRCm39) Q50R possibly damaging Het
Mmrn1 T A 6: 60,953,513 (GRCm39) L598Q probably damaging Het
Mrs2 A G 13: 25,185,767 (GRCm39) I135T probably damaging Het
Neb T C 2: 52,125,592 (GRCm39) D475G Het
Notch2 A G 3: 98,042,915 (GRCm39) S1427G possibly damaging Het
Odad4 G T 11: 100,457,752 (GRCm39) E452* probably null Het
Opcml T C 9: 28,813,447 (GRCm39) F246S probably damaging Het
Or10al2 C A 17: 37,983,302 (GRCm39) Y129* probably null Het
Or2ag1b A T 7: 106,288,296 (GRCm39) I214N probably damaging Het
Or56a42-ps1 A G 7: 104,775,893 (GRCm39) V195A probably benign Het
Or8g33 A C 9: 39,337,515 (GRCm39) V284G possibly damaging Het
Pdzd2 C A 15: 12,402,405 (GRCm39) V729F probably damaging Het
Pias2 C T 18: 77,234,464 (GRCm39) Q565* probably null Het
Pnp T A 14: 51,188,177 (GRCm39) probably null Het
Ptpn18 T C 1: 34,502,211 (GRCm39) S76P probably benign Het
Qtrt2 A T 16: 43,683,560 (GRCm39) L304Q probably damaging Het
Rad51ap2 A T 12: 11,507,401 (GRCm39) E441V possibly damaging Het
Ranbp2 T A 10: 58,313,711 (GRCm39) V1477E probably benign Het
Repin1 C T 6: 48,574,367 (GRCm39) T432I possibly damaging Het
Rest G A 5: 77,430,358 (GRCm39) G926R probably benign Het
Rnft1 T A 11: 86,377,516 (GRCm39) F143L possibly damaging Het
Sema3e A T 5: 14,282,108 (GRCm39) I415L probably benign Het
Slc10a1 T A 12: 81,014,369 (GRCm39) N117I probably damaging Het
Slc25a23 G A 17: 57,366,709 (GRCm39) probably benign Het
Slc2a2 T C 3: 28,767,951 (GRCm39) S160P possibly damaging Het
Srrd A G 5: 112,486,322 (GRCm39) V178A possibly damaging Het
Tmigd3 G T 3: 105,829,277 (GRCm39) G198C probably benign Het
Trbv28 G A 6: 41,248,339 (GRCm39) M1I probably null Het
Tril A G 6: 53,796,569 (GRCm39) S218P probably damaging Het
Trip11 T C 12: 101,828,857 (GRCm39) K1749R probably benign Het
Ttn A G 2: 76,660,995 (GRCm39) V12011A Het
Ubr4 T G 4: 139,137,829 (GRCm39) F1093V probably benign Het
Urb2 C A 8: 124,755,142 (GRCm39) A283E probably benign Het
Usp43 T A 11: 67,789,707 (GRCm39) probably benign Het
Vmn1r28 A T 6: 58,242,669 (GRCm39) I171F probably benign Het
Vps33a G A 5: 123,671,962 (GRCm39) R469W probably damaging Het
Zfp202 G A 9: 40,123,053 (GRCm39) R605Q probably damaging Het
Zpbp2 A T 11: 98,445,446 (GRCm39) H158L probably benign Het
Other mutations in Or6c69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Or6c69 APN 10 129,748,114 (GRCm39) missense possibly damaging 0.89
IGL01650:Or6c69 APN 10 129,747,550 (GRCm39) missense probably benign 0.00
IGL01766:Or6c69 APN 10 129,747,649 (GRCm39) missense probably damaging 1.00
IGL02738:Or6c69 APN 10 129,747,200 (GRCm39) utr 3 prime probably benign
IGL02824:Or6c69 APN 10 129,747,565 (GRCm39) missense probably damaging 1.00
R0401:Or6c69 UTSW 10 129,747,785 (GRCm39) missense probably benign 0.18
R0688:Or6c69 UTSW 10 129,747,752 (GRCm39) missense probably damaging 0.99
R1589:Or6c69 UTSW 10 129,747,550 (GRCm39) missense probably benign 0.00
R1744:Or6c69 UTSW 10 129,747,262 (GRCm39) missense probably damaging 1.00
R2049:Or6c69 UTSW 10 129,748,036 (GRCm39) missense probably benign 0.30
R3763:Or6c69 UTSW 10 129,747,314 (GRCm39) missense probably damaging 1.00
R3952:Or6c69 UTSW 10 129,747,505 (GRCm39) missense probably benign 0.00
R3971:Or6c69 UTSW 10 129,747,742 (GRCm39) missense probably benign 0.01
R4557:Or6c69 UTSW 10 129,747,398 (GRCm39) missense probably damaging 1.00
R5538:Or6c69 UTSW 10 129,747,871 (GRCm39) missense probably benign 0.13
R6127:Or6c69 UTSW 10 129,747,284 (GRCm39) missense probably damaging 1.00
R6227:Or6c69 UTSW 10 129,747,536 (GRCm39) missense probably damaging 1.00
R6394:Or6c69 UTSW 10 129,747,789 (GRCm39) missense probably damaging 1.00
R6707:Or6c69 UTSW 10 129,747,608 (GRCm39) missense probably benign 0.02
R7257:Or6c69 UTSW 10 129,748,156 (GRCm39) start gained probably benign
R7258:Or6c69 UTSW 10 129,748,156 (GRCm39) start gained probably benign
R7260:Or6c69 UTSW 10 129,748,156 (GRCm39) start gained probably benign
R7409:Or6c69 UTSW 10 129,748,120 (GRCm39) missense possibly damaging 0.74
R7539:Or6c69 UTSW 10 129,747,932 (GRCm39) missense probably damaging 1.00
R7782:Or6c69 UTSW 10 129,747,392 (GRCm39) missense probably damaging 1.00
R7984:Or6c69 UTSW 10 129,747,941 (GRCm39) missense probably benign 0.00
R9533:Or6c69 UTSW 10 129,747,404 (GRCm39) missense probably benign 0.20
R9717:Or6c69 UTSW 10 129,748,048 (GRCm39) missense probably damaging 1.00
X0019:Or6c69 UTSW 10 129,747,964 (GRCm39) missense probably damaging 1.00
Z1191:Or6c69 UTSW 10 129,747,826 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGATCACCATTACCAGCGTGAG -3'
(R):5'- GTTACTATGGCAACTGGGGAC -3'

Sequencing Primer
(F):5'- CATTACCAGCGTGAGTAAGAGTGTC -3'
(R):5'- CTGGGGACAAAACCATTTCCTATG -3'
Posted On 2021-07-15