Incidental Mutation 'R8879:Hint1'
ID 676780
Institutional Source Beutler Lab
Gene Symbol Hint1
Ensembl Gene ENSMUSG00000020267
Gene Name histidine triad nucleotide binding protein 1
Synonyms Ipk1, PKCI-1, PKC inhibitor/ interacting protein, protein kinase C inhibitor 1, PRKCNH1
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock # R8879 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 54866383-54870501 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 54869943 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 69 (D69E)
Ref Sequence ENSEMBL: ENSMUSP00000020504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020504] [ENSMUST00000117710]
AlphaFold P70349
Predicted Effect probably benign
Transcript: ENSMUST00000020504
AA Change: D69E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020504
Gene: ENSMUSG00000020267
AA Change: D69E

DomainStartEndE-ValueType
Pfam:DcpS_C 16 123 3.9e-29 PFAM
Pfam:HIT 24 121 7.3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117710
AA Change: D69E

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000114037
Gene: ENSMUSG00000020267
AA Change: D69E

DomainStartEndE-ValueType
Pfam:DcpS_C 16 78 7.6e-16 PFAM
Pfam:HIT 24 84 4.7e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that hydrolyzes purine nucleotide phosphoramidates substrates, including AMP-morpholidate, AMP-N-alanine methyl ester, AMP-alpha-acetyl lysine methyl ester, and AMP-NH2. The encoded protein interacts with these substrates via a histidine triad motif. This gene is considered a tumor suppressor gene. In addition, mutations in this gene can cause autosomal recessive neuromyotonia and axonal neuropathy. There are several related pseudogenes on chromosome 7. Several transcript variants have been observed. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant animals do not exhibit an overt phenotype, though one line of mutant mice was shown to be more susceptible to carcinogen-induced tumors than wild-type. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C T 15: 58,022,509 V326M probably damaging Het
Adap2 T A 11: 80,156,959 H80Q probably benign Het
Ang4 T C 14: 51,764,486 T2A probably benign Het
Arf2 T C 11: 103,979,759 probably null Het
B3gnt4 A G 5: 123,511,148 D192G probably damaging Het
BC034090 T C 1: 155,226,357 I54V probably benign Het
Catsper3 A G 13: 55,804,895 T202A probably benign Het
Cenpe T A 3: 135,260,101 D2113E probably damaging Het
Clasp2 T C 9: 113,773,705 V191A probably benign Het
Col5a1 G T 2: 28,014,158 A1356S unknown Het
Cuzd1 A G 7: 131,308,848 S573P probably damaging Het
Cyp1a2 C A 9: 57,681,885 M215I possibly damaging Het
Dcaf17 T A 2: 71,063,402 I122K possibly damaging Het
Dhcr24 A G 4: 106,573,809 I232V probably benign Het
Dnah10 A G 5: 124,818,117 E3570G probably damaging Het
Dnaja4 A T 9: 54,714,704 probably benign Het
Ehd1 A G 19: 6,298,324 D444G probably damaging Het
Ehmt1 T A 2: 24,836,476 M766L possibly damaging Het
Eno4 A G 19: 58,970,722 I613M probably benign Het
Exoc3l A T 8: 105,290,549 M602K Het
Fam107a C T 14: 8,301,352 probably null Het
Frem3 A T 8: 80,613,148 D690V probably damaging Het
Gm11639 T C 11: 104,690,955 I41T probably benign Het
Gm19410 A T 8: 35,771,868 D97V probably damaging Het
Grik5 T A 7: 25,023,064 D540V possibly damaging Het
Krt13 T C 11: 100,119,385 T257A probably benign Het
Lpin2 T C 17: 71,242,754 L676P probably damaging Het
Lrguk A G 6: 34,029,683 E76G probably benign Het
Lrrc8a A G 2: 30,256,298 M375V probably benign Het
Lrrtm3 T C 10: 64,089,238 Q50R possibly damaging Het
Mmrn1 T A 6: 60,976,529 L598Q probably damaging Het
Mrs2 A G 13: 25,001,784 I135T probably damaging Het
Neb T C 2: 52,235,580 D475G Het
Notch2 A G 3: 98,135,599 S1427G possibly damaging Het
Olfr118 C A 17: 37,672,411 Y129* probably null Het
Olfr682-ps1 A G 7: 105,126,686 V195A probably benign Het
Olfr694 A T 7: 106,689,089 I214N probably damaging Het
Olfr816 A G 10: 129,911,862 C139R probably damaging Het
Olfr952 A C 9: 39,426,219 V284G possibly damaging Het
Opcml T C 9: 28,902,151 F246S probably damaging Het
Pdzd2 C A 15: 12,402,319 V729F probably damaging Het
Pias2 C T 18: 77,146,768 Q565* probably null Het
Pnp T A 14: 50,950,720 probably null Het
Ptpn18 T C 1: 34,463,130 S76P probably benign Het
Qtrt2 A T 16: 43,863,197 L304Q probably damaging Het
Rad51ap2 A T 12: 11,457,400 E441V possibly damaging Het
Ranbp2 T A 10: 58,477,889 V1477E probably benign Het
Repin1 C T 6: 48,597,433 T432I possibly damaging Het
Rest G A 5: 77,282,511 G926R probably benign Het
Rnft1 T A 11: 86,486,690 F143L possibly damaging Het
Sema3e A T 5: 14,232,094 I415L probably benign Het
Slc10a1 T A 12: 80,967,595 N117I probably damaging Het
Slc25a23 G A 17: 57,059,709 probably benign Het
Slc2a2 T C 3: 28,713,802 S160P possibly damaging Het
Srrd A G 5: 112,338,456 V178A possibly damaging Het
Tmigd3 G T 3: 105,921,961 G198C probably benign Het
Trbv29 G A 6: 41,271,405 M1I probably null Het
Tril A G 6: 53,819,584 S218P probably damaging Het
Trip11 T C 12: 101,862,598 K1749R probably benign Het
Ttc25 G T 11: 100,566,926 E452* probably null Het
Ttn A G 2: 76,830,651 V12011A Het
Ubr4 T G 4: 139,410,518 F1093V probably benign Het
Urb2 C A 8: 124,028,403 A283E probably benign Het
Usp43 T A 11: 67,898,881 probably benign Het
Vmn1r28 A T 6: 58,265,684 I171F probably benign Het
Vps33a G A 5: 123,533,899 R469W probably damaging Het
Zfp202 G A 9: 40,211,757 R605Q probably damaging Het
Zpbp2 A T 11: 98,554,620 H158L probably benign Het
Other mutations in Hint1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02621:Hint1 APN 11 54870185 utr 3 prime probably benign
PIT4469001:Hint1 UTSW 11 54870070 missense unknown
R6312:Hint1 UTSW 11 54869990 missense probably benign 0.10
R8391:Hint1 UTSW 11 54866542 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GTTTGGTGCCTCCCATTCAAAC -3'
(R):5'- CAGAAAATGTACACTGCTGACC -3'

Sequencing Primer
(F):5'- GCCTCCCATTCAAACTGCTTGAC -3'
(R):5'- TGTACACTGCTGACCACTAAATAAC -3'
Posted On 2021-07-15