Incidental Mutation 'R8879:Adap2'
ID676781
Institutional Source Beutler Lab
Gene Symbol Adap2
Ensembl Gene ENSMUSG00000020709
Gene NameArfGAP with dual PH domains 2
Synonymscentaurin alpha 2, Centa2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R8879 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location80154105-80178958 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80156959 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 80 (H80Q)
Ref Sequence ENSEMBL: ENSMUSP00000021050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021050] [ENSMUST00000134118]
Predicted Effect probably benign
Transcript: ENSMUST00000021050
AA Change: H80Q

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000021050
Gene: ENSMUSG00000020709
AA Change: H80Q

DomainStartEndE-ValueType
ArfGap 9 130 1.62e-42 SMART
PH 133 235 4.57e-8 SMART
PH 256 363 2.35e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134118
AA Change: H80Q

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000130731
Gene: ENSMUSG00000020709
AA Change: H80Q

DomainStartEndE-ValueType
ArfGap 9 130 1.62e-42 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds beta-tubulin and increases the stability of microtubules. The encoded protein can also translocate to the cell membrane and bind phosphatidylinositol 3,4,5-trisphosphate (PtdInsP3) and inositol 1,3,4,5-tetrakisphosphate (InsP4). In addition, this protein is a GTPase-activating protein for ADP ribosylation factor 6 and may be able to block the entry of some RNA viruses. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C T 15: 58,022,509 V326M probably damaging Het
Ang4 T C 14: 51,764,486 T2A probably benign Het
Arf2 T C 11: 103,979,759 probably null Het
B3gnt4 A G 5: 123,511,148 D192G probably damaging Het
BC034090 T C 1: 155,226,357 I54V probably benign Het
Catsper3 A G 13: 55,804,895 T202A probably benign Het
Cenpe T A 3: 135,260,101 D2113E probably damaging Het
Clasp2 T C 9: 113,773,705 V191A probably benign Het
Col5a1 G T 2: 28,014,158 A1356S unknown Het
Cuzd1 A G 7: 131,308,848 S573P probably damaging Het
Cyp1a2 C A 9: 57,681,885 M215I possibly damaging Het
Dcaf17 T A 2: 71,063,402 I122K possibly damaging Het
Dhcr24 A G 4: 106,573,809 I232V probably benign Het
Dnah10 A G 5: 124,818,117 E3570G probably damaging Het
Ehd1 A G 19: 6,298,324 D444G probably damaging Het
Ehmt1 T A 2: 24,836,476 M766L possibly damaging Het
Eno4 A G 19: 58,970,722 I613M probably benign Het
Exoc3l A T 8: 105,290,549 M602K Het
Fam107a C T 14: 8,301,352 probably null Het
Frem3 A T 8: 80,613,148 D690V probably damaging Het
Gm11639 T C 11: 104,690,955 I41T probably benign Het
Gm19410 A T 8: 35,771,868 D97V probably damaging Het
Gm21886 GCTCACTGAGGCCTGCAGACAGTAGGTACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGT GCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGT 18: 80,089,798 probably benign Het
Grik5 T A 7: 25,023,064 D540V possibly damaging Het
Hint1 T A 11: 54,869,943 D69E probably benign Het
Krt13 T C 11: 100,119,385 T257A probably benign Het
Lpin2 T C 17: 71,242,754 L676P probably damaging Het
Lrguk A G 6: 34,029,683 E76G probably benign Het
Lrrc8a A G 2: 30,256,298 M375V probably benign Het
Lrrtm3 T C 10: 64,089,238 Q50R possibly damaging Het
Mmrn1 T A 6: 60,976,529 L598Q probably damaging Het
Mrs2 A G 13: 25,001,784 I135T probably damaging Het
Neb T C 2: 52,235,580 D475G Het
Notch2 A G 3: 98,135,599 S1427G possibly damaging Het
Olfr118 C A 17: 37,672,411 Y129* probably null Het
Olfr682-ps1 A G 7: 105,126,686 V195A probably benign Het
Olfr694 A T 7: 106,689,089 I214N probably damaging Het
Olfr816 A G 10: 129,911,862 C139R probably damaging Het
Olfr952 A C 9: 39,426,219 V284G possibly damaging Het
Opcml T C 9: 28,902,151 F246S probably damaging Het
Pdzd2 C A 15: 12,402,319 V729F probably damaging Het
Pias2 C T 18: 77,146,768 Q565* probably null Het
Pnp T A 14: 50,950,720 probably null Het
Ptpn18 T C 1: 34,463,130 S76P probably benign Het
Qtrt2 A T 16: 43,863,197 L304Q probably damaging Het
Rad51ap2 A T 12: 11,457,400 E441V possibly damaging Het
Ranbp2 T A 10: 58,477,889 V1477E probably benign Het
Repin1 C T 6: 48,597,433 T432I possibly damaging Het
Rest G A 5: 77,282,511 G926R probably benign Het
Rnft1 T A 11: 86,486,690 F143L possibly damaging Het
Sema3e A T 5: 14,232,094 I415L probably benign Het
Slc10a1 T A 12: 80,967,595 N117I probably damaging Het
Slc25a23 G A 17: 57,059,709 probably benign Het
Slc2a2 T C 3: 28,713,802 S160P possibly damaging Het
Srrd A G 5: 112,338,456 V178A possibly damaging Het
Tmigd3 G T 3: 105,921,961 G198C probably benign Het
Trbv29 G A 6: 41,271,405 M1I probably null Het
Tril A G 6: 53,819,584 S218P probably damaging Het
Trip11 T C 12: 101,862,598 K1749R probably benign Het
Ttc25 G T 11: 100,566,926 E452* probably null Het
Ttn A G 2: 76,830,651 V12011A Het
Ubr4 T G 4: 139,410,518 F1093V probably benign Het
Urb2 C A 8: 124,028,403 A283E probably benign Het
Vmn1r28 A T 6: 58,265,684 I171F probably benign Het
Vps33a G A 5: 123,533,899 R469W probably damaging Het
Zfp202 G A 9: 40,211,757 R605Q probably damaging Het
Zpbp2 A T 11: 98,554,620 H158L probably benign Het
Other mutations in Adap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02383:Adap2 APN 11 80160189 missense probably damaging 1.00
IGL02442:Adap2 APN 11 80177206 missense probably damaging 1.00
IGL02953:Adap2 APN 11 80154300 missense probably damaging 0.99
PIT4283001:Adap2 UTSW 11 80177263 missense probably damaging 1.00
R0157:Adap2 UTSW 11 80165701 missense probably damaging 1.00
R0382:Adap2 UTSW 11 80178385 splice site probably benign
R0499:Adap2 UTSW 11 80176079 missense probably damaging 1.00
R0722:Adap2 UTSW 11 80156984 missense possibly damaging 0.86
R0828:Adap2 UTSW 11 80165664 splice site probably benign
R1938:Adap2 UTSW 11 80170682 missense probably damaging 1.00
R2268:Adap2 UTSW 11 80165726 missense probably damaging 0.99
R3103:Adap2 UTSW 11 80157033 missense probably damaging 1.00
R4621:Adap2 UTSW 11 80174073 splice site probably null
R5157:Adap2 UTSW 11 80156946 missense probably damaging 1.00
R6326:Adap2 UTSW 11 80155022 missense probably damaging 1.00
R6914:Adap2 UTSW 11 80155065 missense probably benign 0.01
R6942:Adap2 UTSW 11 80155065 missense probably benign 0.01
R7835:Adap2 UTSW 11 80160231 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GCCTCAGAGCCAGTGAAAAC -3'
(R):5'- TCCTTCCATCCAGATCACAGGAG -3'

Sequencing Primer
(F):5'- TAGAACAGGCTGGCCTTGAACTC -3'
(R):5'- TTCCATCCAGATCACAGGAGAACTC -3'
Posted On2021-07-15