Mutagenetix > Incidental Mutation

Incidental Mutation 'R8879:Krt13'

676784

Institutional Source

Beutler Lab

Gene Symbol

Krt13

Ensembl Gene

ENSMUSG00000044041

Gene Name

keratin 13

Synonyms

K13, Krt-1.13, Krt1-13

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.169) question?

Stock #

R8879 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100117327-100121566 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 100119385 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 257 (T257A)

Ref Sequence

ENSEMBL: ENSMUSP00000007275 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000007275]

AlphaFold

P08730

Predicted Effect

probably benign
Transcript: ENSMUST00000007275
AA Change: T257A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000007275
Gene: ENSMUSG00000044041
AA Change: T257A

Domain	Start	End	E-Value	Type
internal_repeat_1	5	21	1.02e-5	PROSPERO
internal_repeat_1	16	32	1.02e-5	PROSPERO
low complexity region	39	94	N/A	INTRINSIC
Filament	95	407	7.21e-169	SMART
low complexity region	409	430	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. This type I cytokeratin is paired with keratin 4 and expressed in the suprabasal layers of non-cornified stratified epithelia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130401M01Rik	C	T	15: 58,022,509	V326M	probably damaging	Het
Adap2	T	A	11: 80,156,959	H80Q	probably benign	Het
Ang4	T	C	14: 51,764,486	T2A	probably benign	Het
Arf2	T	C	11: 103,979,759		probably null	Het
B3gnt4	A	G	5: 123,511,148	D192G	probably damaging	Het
BC034090	T	C	1: 155,226,357	I54V	probably benign	Het
Catsper3	A	G	13: 55,804,895	T202A	probably benign	Het
Cenpe	T	A	3: 135,260,101	D2113E	probably damaging	Het
Clasp2	T	C	9: 113,773,705	V191A	probably benign	Het
Col5a1	G	T	2: 28,014,158	A1356S	unknown	Het
Cuzd1	A	G	7: 131,308,848	S573P	probably damaging	Het
Cyp1a2	C	A	9: 57,681,885	M215I	possibly damaging	Het
Dcaf17	T	A	2: 71,063,402	I122K	possibly damaging	Het
Dhcr24	A	G	4: 106,573,809	I232V	probably benign	Het
Dnah10	A	G	5: 124,818,117	E3570G	probably damaging	Het
Dnaja4	A	T	9: 54,714,704		probably benign	Het
Ehd1	A	G	19: 6,298,324	D444G	probably damaging	Het
Ehmt1	T	A	2: 24,836,476	M766L	possibly damaging	Het
Eno4	A	G	19: 58,970,722	I613M	probably benign	Het
Exoc3l	A	T	8: 105,290,549	M602K		Het
Fam107a	C	T	14: 8,301,352		probably null	Het
Frem3	A	T	8: 80,613,148	D690V	probably damaging	Het
Gm11639	T	C	11: 104,690,955	I41T	probably benign	Het
Gm19410	A	T	8: 35,771,868	D97V	probably damaging	Het
Grik5	T	A	7: 25,023,064	D540V	possibly damaging	Het
Hint1	T	A	11: 54,869,943	D69E	probably benign	Het
Lpin2	T	C	17: 71,242,754	L676P	probably damaging	Het
Lrguk	A	G	6: 34,029,683	E76G	probably benign	Het
Lrrc8a	A	G	2: 30,256,298	M375V	probably benign	Het
Lrrtm3	T	C	10: 64,089,238	Q50R	possibly damaging	Het
Mmrn1	T	A	6: 60,976,529	L598Q	probably damaging	Het
Mrs2	A	G	13: 25,001,784	I135T	probably damaging	Het
Neb	T	C	2: 52,235,580	D475G		Het
Notch2	A	G	3: 98,135,599	S1427G	possibly damaging	Het
Olfr118	C	A	17: 37,672,411	Y129*	probably null	Het
Olfr682-ps1	A	G	7: 105,126,686	V195A	probably benign	Het
Olfr694	A	T	7: 106,689,089	I214N	probably damaging	Het
Olfr816	A	G	10: 129,911,862	C139R	probably damaging	Het
Olfr952	A	C	9: 39,426,219	V284G	possibly damaging	Het
Opcml	T	C	9: 28,902,151	F246S	probably damaging	Het
Pdzd2	C	A	15: 12,402,319	V729F	probably damaging	Het
Pias2	C	T	18: 77,146,768	Q565*	probably null	Het
Pnp	T	A	14: 50,950,720		probably null	Het
Ptpn18	T	C	1: 34,463,130	S76P	probably benign	Het
Qtrt2	A	T	16: 43,863,197	L304Q	probably damaging	Het
Rad51ap2	A	T	12: 11,457,400	E441V	possibly damaging	Het
Ranbp2	T	A	10: 58,477,889	V1477E	probably benign	Het
Repin1	C	T	6: 48,597,433	T432I	possibly damaging	Het
Rest	G	A	5: 77,282,511	G926R	probably benign	Het
Rnft1	T	A	11: 86,486,690	F143L	possibly damaging	Het
Sema3e	A	T	5: 14,232,094	I415L	probably benign	Het
Slc10a1	T	A	12: 80,967,595	N117I	probably damaging	Het
Slc25a23	G	A	17: 57,059,709		probably benign	Het
Slc2a2	T	C	3: 28,713,802	S160P	possibly damaging	Het
Srrd	A	G	5: 112,338,456	V178A	possibly damaging	Het
Tmigd3	G	T	3: 105,921,961	G198C	probably benign	Het
Trbv29	G	A	6: 41,271,405	M1I	probably null	Het
Tril	A	G	6: 53,819,584	S218P	probably damaging	Het
Trip11	T	C	12: 101,862,598	K1749R	probably benign	Het
Ttc25	G	T	11: 100,566,926	E452*	probably null	Het
Ttn	A	G	2: 76,830,651	V12011A		Het
Ubr4	T	G	4: 139,410,518	F1093V	probably benign	Het
Urb2	C	A	8: 124,028,403	A283E	probably benign	Het
Usp43	T	A	11: 67,898,881		probably benign	Het
Vmn1r28	A	T	6: 58,265,684	I171F	probably benign	Het
Vps33a	G	A	5: 123,533,899	R469W	probably damaging	Het
Zfp202	G	A	9: 40,211,757	R605Q	probably damaging	Het
Zpbp2	A	T	11: 98,554,620	H158L	probably benign	Het

Other mutations in Krt13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01780:Krt13	APN	11	100119713	missense	probably damaging	1.00
IGL02532:Krt13	APN	11	100119369	missense	probably damaging	1.00
IGL02934:Krt13	APN	11	100119084	missense	probably damaging	0.99
PIT4651001:Krt13	UTSW	11	100120036	missense	probably damaging	0.98
R0092:Krt13	UTSW	11	100121432	nonsense	probably null
R0722:Krt13	UTSW	11	100119153	missense	probably damaging	1.00
R1228:Krt13	UTSW	11	100121477	missense	probably benign	0.18
R1400:Krt13	UTSW	11	100121284	missense	probably damaging	1.00
R1751:Krt13	UTSW	11	100121100	missense	possibly damaging	0.84
R1767:Krt13	UTSW	11	100121100	missense	possibly damaging	0.84
R2420:Krt13	UTSW	11	100120051	missense	probably benign	0.43
R2421:Krt13	UTSW	11	100120051	missense	probably benign	0.43
R2869:Krt13	UTSW	11	100117649	missense	unknown
R2869:Krt13	UTSW	11	100117649	missense	unknown
R4421:Krt13	UTSW	11	100118935	missense	possibly damaging	0.94
R4451:Krt13	UTSW	11	100118001	missense	unknown
R4520:Krt13	UTSW	11	100119348	missense	probably damaging	0.99
R4632:Krt13	UTSW	11	100121224	missense	possibly damaging	0.96
R4656:Krt13	UTSW	11	100119363	missense	probably damaging	1.00
R4872:Krt13	UTSW	11	100121506	start gained	probably benign
R5709:Krt13	UTSW	11	100117643	missense	unknown
R6014:Krt13	UTSW	11	100117611	missense	unknown
R6323:Krt13	UTSW	11	100121150	missense	probably damaging	1.00
R6391:Krt13	UTSW	11	100119376	missense	probably damaging	0.96
R7535:Krt13	UTSW	11	100117998	missense	unknown
R7562:Krt13	UTSW	11	100119336	missense	probably damaging	1.00
R7867:Krt13	UTSW	11	100121182	missense	probably damaging	1.00
R7992:Krt13	UTSW	11	100117652	missense	unknown
R8379:Krt13	UTSW	11	100118880	missense	probably damaging	0.99
R8429:Krt13	UTSW	11	100121125	missense	probably damaging	1.00
R8560:Krt13	UTSW	11	100118850	missense	possibly damaging	0.85
R8728:Krt13	UTSW	11	100121492	missense	probably null	0.73
R8973:Krt13	UTSW	11	100119438	missense	possibly damaging	0.83
R9610:Krt13	UTSW	11	100121492	missense	probably benign	0.18
R9611:Krt13	UTSW	11	100121492	missense	probably benign	0.18
R9746:Krt13	UTSW	11	100121161	missense	possibly damaging	0.90
X0013:Krt13	UTSW	11	100119348	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCTCTGCACTCTAAAAGTCAAG -3'
(R):5'- TGTTGCAGGCTGACATTGC -3'

Sequencing Primer
(F):5'- CTGCACTCTAAAAGTCAAGTAGAAAG -3'
(R):5'- ATTGCCACCAGCTGAGGGATTC -3'

Posted On

2021-07-15