Incidental Mutation 'R8879:Krt13'
ID 676784
Institutional Source Beutler Lab
Gene Symbol Krt13
Ensembl Gene ENSMUSG00000044041
Gene Name keratin 13
Synonyms Krt1-13, K13, Krt-1.13
MMRRC Submission 068747-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.121) question?
Stock # R8879 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 100008153-100012392 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100010211 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 257 (T257A)
Ref Sequence ENSEMBL: ENSMUSP00000007275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007275]
AlphaFold P08730
Predicted Effect probably benign
Transcript: ENSMUST00000007275
AA Change: T257A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000007275
Gene: ENSMUSG00000044041
AA Change: T257A

DomainStartEndE-ValueType
internal_repeat_1 5 21 1.02e-5 PROSPERO
internal_repeat_1 16 32 1.02e-5 PROSPERO
low complexity region 39 94 N/A INTRINSIC
Filament 95 407 7.21e-169 SMART
low complexity region 409 430 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. This type I cytokeratin is paired with keratin 4 and expressed in the suprabasal layers of non-cornified stratified epithelia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C T 15: 57,885,905 (GRCm39) V326M probably damaging Het
Adap2 T A 11: 80,047,785 (GRCm39) H80Q probably benign Het
Ang4 T C 14: 52,001,943 (GRCm39) T2A probably benign Het
Arf2 T C 11: 103,870,585 (GRCm39) probably null Het
B3gnt4 A G 5: 123,649,211 (GRCm39) D192G probably damaging Het
BC034090 T C 1: 155,102,103 (GRCm39) I54V probably benign Het
Catsper3 A G 13: 55,952,708 (GRCm39) T202A probably benign Het
Cenpe T A 3: 134,965,862 (GRCm39) D2113E probably damaging Het
Clasp2 T C 9: 113,602,773 (GRCm39) V191A probably benign Het
Col5a1 G T 2: 27,904,170 (GRCm39) A1356S unknown Het
Cuzd1 A G 7: 130,910,577 (GRCm39) S573P probably damaging Het
Cyp1a2 C A 9: 57,589,168 (GRCm39) M215I possibly damaging Het
Dcaf17 T A 2: 70,893,746 (GRCm39) I122K possibly damaging Het
Dhcr24 A G 4: 106,431,006 (GRCm39) I232V probably benign Het
Dnah10 A G 5: 124,895,181 (GRCm39) E3570G probably damaging Het
Dnaja4 A T 9: 54,621,988 (GRCm39) probably benign Het
Efcab3 T C 11: 104,581,781 (GRCm39) I41T probably benign Het
Ehd1 A G 19: 6,348,354 (GRCm39) D444G probably damaging Het
Ehmt1 T A 2: 24,726,488 (GRCm39) M766L possibly damaging Het
Eno4 A G 19: 58,959,154 (GRCm39) I613M probably benign Het
Exoc3l A T 8: 106,017,181 (GRCm39) M602K Het
Fam107a C T 14: 8,301,352 (GRCm38) probably null Het
Frem3 A T 8: 81,339,777 (GRCm39) D690V probably damaging Het
Gm19410 A T 8: 36,239,022 (GRCm39) D97V probably damaging Het
Grik5 T A 7: 24,722,489 (GRCm39) D540V possibly damaging Het
Hint1 T A 11: 54,760,769 (GRCm39) D69E probably benign Het
Lpin2 T C 17: 71,549,749 (GRCm39) L676P probably damaging Het
Lrguk A G 6: 34,006,618 (GRCm39) E76G probably benign Het
Lrrc8a A G 2: 30,146,310 (GRCm39) M375V probably benign Het
Lrrtm3 T C 10: 63,925,017 (GRCm39) Q50R possibly damaging Het
Mmrn1 T A 6: 60,953,513 (GRCm39) L598Q probably damaging Het
Mrs2 A G 13: 25,185,767 (GRCm39) I135T probably damaging Het
Neb T C 2: 52,125,592 (GRCm39) D475G Het
Notch2 A G 3: 98,042,915 (GRCm39) S1427G possibly damaging Het
Odad4 G T 11: 100,457,752 (GRCm39) E452* probably null Het
Opcml T C 9: 28,813,447 (GRCm39) F246S probably damaging Het
Or10al2 C A 17: 37,983,302 (GRCm39) Y129* probably null Het
Or2ag1b A T 7: 106,288,296 (GRCm39) I214N probably damaging Het
Or56a42-ps1 A G 7: 104,775,893 (GRCm39) V195A probably benign Het
Or6c69 A G 10: 129,747,731 (GRCm39) C139R probably damaging Het
Or8g33 A C 9: 39,337,515 (GRCm39) V284G possibly damaging Het
Pdzd2 C A 15: 12,402,405 (GRCm39) V729F probably damaging Het
Pias2 C T 18: 77,234,464 (GRCm39) Q565* probably null Het
Pnp T A 14: 51,188,177 (GRCm39) probably null Het
Ptpn18 T C 1: 34,502,211 (GRCm39) S76P probably benign Het
Qtrt2 A T 16: 43,683,560 (GRCm39) L304Q probably damaging Het
Rad51ap2 A T 12: 11,507,401 (GRCm39) E441V possibly damaging Het
Ranbp2 T A 10: 58,313,711 (GRCm39) V1477E probably benign Het
Repin1 C T 6: 48,574,367 (GRCm39) T432I possibly damaging Het
Rest G A 5: 77,430,358 (GRCm39) G926R probably benign Het
Rnft1 T A 11: 86,377,516 (GRCm39) F143L possibly damaging Het
Sema3e A T 5: 14,282,108 (GRCm39) I415L probably benign Het
Slc10a1 T A 12: 81,014,369 (GRCm39) N117I probably damaging Het
Slc25a23 G A 17: 57,366,709 (GRCm39) probably benign Het
Slc2a2 T C 3: 28,767,951 (GRCm39) S160P possibly damaging Het
Srrd A G 5: 112,486,322 (GRCm39) V178A possibly damaging Het
Tmigd3 G T 3: 105,829,277 (GRCm39) G198C probably benign Het
Trbv28 G A 6: 41,248,339 (GRCm39) M1I probably null Het
Tril A G 6: 53,796,569 (GRCm39) S218P probably damaging Het
Trip11 T C 12: 101,828,857 (GRCm39) K1749R probably benign Het
Ttn A G 2: 76,660,995 (GRCm39) V12011A Het
Ubr4 T G 4: 139,137,829 (GRCm39) F1093V probably benign Het
Urb2 C A 8: 124,755,142 (GRCm39) A283E probably benign Het
Usp43 T A 11: 67,789,707 (GRCm39) probably benign Het
Vmn1r28 A T 6: 58,242,669 (GRCm39) I171F probably benign Het
Vps33a G A 5: 123,671,962 (GRCm39) R469W probably damaging Het
Zfp202 G A 9: 40,123,053 (GRCm39) R605Q probably damaging Het
Zpbp2 A T 11: 98,445,446 (GRCm39) H158L probably benign Het
Other mutations in Krt13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01780:Krt13 APN 11 100,010,539 (GRCm39) missense probably damaging 1.00
IGL02532:Krt13 APN 11 100,010,195 (GRCm39) missense probably damaging 1.00
IGL02934:Krt13 APN 11 100,009,910 (GRCm39) missense probably damaging 0.99
PIT4651001:Krt13 UTSW 11 100,010,862 (GRCm39) missense probably damaging 0.98
R0092:Krt13 UTSW 11 100,012,258 (GRCm39) nonsense probably null
R0722:Krt13 UTSW 11 100,009,979 (GRCm39) missense probably damaging 1.00
R1228:Krt13 UTSW 11 100,012,303 (GRCm39) missense probably benign 0.18
R1400:Krt13 UTSW 11 100,012,110 (GRCm39) missense probably damaging 1.00
R1751:Krt13 UTSW 11 100,011,926 (GRCm39) missense possibly damaging 0.84
R1767:Krt13 UTSW 11 100,011,926 (GRCm39) missense possibly damaging 0.84
R2420:Krt13 UTSW 11 100,010,877 (GRCm39) missense probably benign 0.43
R2421:Krt13 UTSW 11 100,010,877 (GRCm39) missense probably benign 0.43
R2869:Krt13 UTSW 11 100,008,475 (GRCm39) missense unknown
R2869:Krt13 UTSW 11 100,008,475 (GRCm39) missense unknown
R4421:Krt13 UTSW 11 100,009,761 (GRCm39) missense possibly damaging 0.94
R4451:Krt13 UTSW 11 100,008,827 (GRCm39) missense unknown
R4520:Krt13 UTSW 11 100,010,174 (GRCm39) missense probably damaging 0.99
R4632:Krt13 UTSW 11 100,012,050 (GRCm39) missense possibly damaging 0.96
R4656:Krt13 UTSW 11 100,010,189 (GRCm39) missense probably damaging 1.00
R4872:Krt13 UTSW 11 100,012,332 (GRCm39) start gained probably benign
R5709:Krt13 UTSW 11 100,008,469 (GRCm39) missense unknown
R6014:Krt13 UTSW 11 100,008,437 (GRCm39) missense unknown
R6323:Krt13 UTSW 11 100,011,976 (GRCm39) missense probably damaging 1.00
R6391:Krt13 UTSW 11 100,010,202 (GRCm39) missense probably damaging 0.96
R7535:Krt13 UTSW 11 100,008,824 (GRCm39) missense unknown
R7562:Krt13 UTSW 11 100,010,162 (GRCm39) missense probably damaging 1.00
R7867:Krt13 UTSW 11 100,012,008 (GRCm39) missense probably damaging 1.00
R7992:Krt13 UTSW 11 100,008,478 (GRCm39) missense unknown
R8379:Krt13 UTSW 11 100,009,706 (GRCm39) missense probably damaging 0.99
R8429:Krt13 UTSW 11 100,011,951 (GRCm39) missense probably damaging 1.00
R8560:Krt13 UTSW 11 100,009,676 (GRCm39) missense possibly damaging 0.85
R8728:Krt13 UTSW 11 100,012,318 (GRCm39) missense probably null 0.73
R8973:Krt13 UTSW 11 100,010,264 (GRCm39) missense possibly damaging 0.83
R9610:Krt13 UTSW 11 100,012,318 (GRCm39) missense probably benign 0.18
R9611:Krt13 UTSW 11 100,012,318 (GRCm39) missense probably benign 0.18
R9746:Krt13 UTSW 11 100,011,987 (GRCm39) missense possibly damaging 0.90
X0013:Krt13 UTSW 11 100,010,174 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTCTGCACTCTAAAAGTCAAG -3'
(R):5'- TGTTGCAGGCTGACATTGC -3'

Sequencing Primer
(F):5'- CTGCACTCTAAAAGTCAAGTAGAAAG -3'
(R):5'- ATTGCCACCAGCTGAGGGATTC -3'
Posted On 2021-07-15