Incidental Mutation 'R8879:Ttc25'
ID 676785
Institutional Source Beutler Lab
Gene Symbol Ttc25
Ensembl Gene ENSMUSG00000006784
Gene Name tetratricopeptide repeat domain 25
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock # R8879 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 100545607-100572568 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 100566926 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 452 (E452*)
Ref Sequence ENSEMBL: ENSMUSP00000090355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006976] [ENSMUST00000092684]
AlphaFold Q9D4B2
Predicted Effect probably null
Transcript: ENSMUST00000006976
AA Change: E452*
SMART Domains Protein: ENSMUSP00000006976
Gene: ENSMUSG00000006784
AA Change: E452*

DomainStartEndE-ValueType
TPR 11 44 3.69e1 SMART
TPR 45 78 3.07e1 SMART
TPR 79 112 4.96e0 SMART
low complexity region 147 158 N/A INTRINSIC
low complexity region 191 208 N/A INTRINSIC
TPR 318 351 4.96e0 SMART
TPR 358 391 1.11e1 SMART
Blast:TPR 395 428 7e-14 BLAST
TPR 435 468 2.99e1 SMART
low complexity region 493 505 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000092684
AA Change: E452*
SMART Domains Protein: ENSMUSP00000090355
Gene: ENSMUSG00000006784
AA Change: E452*

DomainStartEndE-ValueType
TPR 11 44 3.69e1 SMART
TPR 45 78 3.07e1 SMART
TPR 79 112 4.96e0 SMART
low complexity region 147 158 N/A INTRINSIC
low complexity region 191 208 N/A INTRINSIC
TPR 318 351 4.96e0 SMART
TPR 358 391 1.11e1 SMART
Blast:TPR 395 428 5e-14 BLAST
TPR 435 468 2.99e1 SMART
coiled coil region 528 548 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
coiled coil region 599 624 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (69/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display partial preweaning lethality, impaired ciliary motility, and a variety of left-right body symmetry defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C T 15: 58,022,509 V326M probably damaging Het
Adap2 T A 11: 80,156,959 H80Q probably benign Het
Ang4 T C 14: 51,764,486 T2A probably benign Het
Arf2 T C 11: 103,979,759 probably null Het
B3gnt4 A G 5: 123,511,148 D192G probably damaging Het
BC034090 T C 1: 155,226,357 I54V probably benign Het
Catsper3 A G 13: 55,804,895 T202A probably benign Het
Cenpe T A 3: 135,260,101 D2113E probably damaging Het
Clasp2 T C 9: 113,773,705 V191A probably benign Het
Col5a1 G T 2: 28,014,158 A1356S unknown Het
Cuzd1 A G 7: 131,308,848 S573P probably damaging Het
Cyp1a2 C A 9: 57,681,885 M215I possibly damaging Het
Dcaf17 T A 2: 71,063,402 I122K possibly damaging Het
Dhcr24 A G 4: 106,573,809 I232V probably benign Het
Dnah10 A G 5: 124,818,117 E3570G probably damaging Het
Dnaja4 A T 9: 54,714,704 probably benign Het
Ehd1 A G 19: 6,298,324 D444G probably damaging Het
Ehmt1 T A 2: 24,836,476 M766L possibly damaging Het
Eno4 A G 19: 58,970,722 I613M probably benign Het
Exoc3l A T 8: 105,290,549 M602K Het
Fam107a C T 14: 8,301,352 probably null Het
Frem3 A T 8: 80,613,148 D690V probably damaging Het
Gm11639 T C 11: 104,690,955 I41T probably benign Het
Gm19410 A T 8: 35,771,868 D97V probably damaging Het
Grik5 T A 7: 25,023,064 D540V possibly damaging Het
Hint1 T A 11: 54,869,943 D69E probably benign Het
Krt13 T C 11: 100,119,385 T257A probably benign Het
Lpin2 T C 17: 71,242,754 L676P probably damaging Het
Lrguk A G 6: 34,029,683 E76G probably benign Het
Lrrc8a A G 2: 30,256,298 M375V probably benign Het
Lrrtm3 T C 10: 64,089,238 Q50R possibly damaging Het
Mmrn1 T A 6: 60,976,529 L598Q probably damaging Het
Mrs2 A G 13: 25,001,784 I135T probably damaging Het
Neb T C 2: 52,235,580 D475G Het
Notch2 A G 3: 98,135,599 S1427G possibly damaging Het
Olfr118 C A 17: 37,672,411 Y129* probably null Het
Olfr682-ps1 A G 7: 105,126,686 V195A probably benign Het
Olfr694 A T 7: 106,689,089 I214N probably damaging Het
Olfr816 A G 10: 129,911,862 C139R probably damaging Het
Olfr952 A C 9: 39,426,219 V284G possibly damaging Het
Opcml T C 9: 28,902,151 F246S probably damaging Het
Pdzd2 C A 15: 12,402,319 V729F probably damaging Het
Pias2 C T 18: 77,146,768 Q565* probably null Het
Pnp T A 14: 50,950,720 probably null Het
Ptpn18 T C 1: 34,463,130 S76P probably benign Het
Qtrt2 A T 16: 43,863,197 L304Q probably damaging Het
Rad51ap2 A T 12: 11,457,400 E441V possibly damaging Het
Ranbp2 T A 10: 58,477,889 V1477E probably benign Het
Repin1 C T 6: 48,597,433 T432I possibly damaging Het
Rest G A 5: 77,282,511 G926R probably benign Het
Rnft1 T A 11: 86,486,690 F143L possibly damaging Het
Sema3e A T 5: 14,232,094 I415L probably benign Het
Slc10a1 T A 12: 80,967,595 N117I probably damaging Het
Slc25a23 G A 17: 57,059,709 probably benign Het
Slc2a2 T C 3: 28,713,802 S160P possibly damaging Het
Srrd A G 5: 112,338,456 V178A possibly damaging Het
Tmigd3 G T 3: 105,921,961 G198C probably benign Het
Trbv29 G A 6: 41,271,405 M1I probably null Het
Tril A G 6: 53,819,584 S218P probably damaging Het
Trip11 T C 12: 101,862,598 K1749R probably benign Het
Ttn A G 2: 76,830,651 V12011A Het
Ubr4 T G 4: 139,410,518 F1093V probably benign Het
Urb2 C A 8: 124,028,403 A283E probably benign Het
Usp43 T A 11: 67,898,881 probably benign Het
Vmn1r28 A T 6: 58,265,684 I171F probably benign Het
Vps33a G A 5: 123,533,899 R469W probably damaging Het
Zfp202 G A 9: 40,211,757 R605Q probably damaging Het
Zpbp2 A T 11: 98,554,620 H158L probably benign Het
Other mutations in Ttc25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Ttc25 APN 11 100569902 missense probably damaging 1.00
IGL02379:Ttc25 APN 11 100566983 missense possibly damaging 0.87
IGL03091:Ttc25 APN 11 100550250 nonsense probably null
IGL02991:Ttc25 UTSW 11 100553872 missense probably benign 0.01
R0044:Ttc25 UTSW 11 100567001 missense probably damaging 1.00
R0137:Ttc25 UTSW 11 100563568 missense probably damaging 1.00
R0280:Ttc25 UTSW 11 100550265 missense probably damaging 1.00
R1373:Ttc25 UTSW 11 100545832 missense probably damaging 1.00
R1793:Ttc25 UTSW 11 100569853 splice site probably null
R2097:Ttc25 UTSW 11 100563582 missense possibly damaging 0.89
R2121:Ttc25 UTSW 11 100567011 critical splice donor site probably null
R2509:Ttc25 UTSW 11 100553535 missense probably damaging 0.99
R2655:Ttc25 UTSW 11 100553579 missense probably damaging 1.00
R4635:Ttc25 UTSW 11 100551507 nonsense probably null
R4773:Ttc25 UTSW 11 100549916 missense probably benign 0.05
R4858:Ttc25 UTSW 11 100550321 missense probably damaging 0.96
R5164:Ttc25 UTSW 11 100571520 nonsense probably null
R5181:Ttc25 UTSW 11 100549893 missense probably damaging 1.00
R5707:Ttc25 UTSW 11 100554061 missense probably damaging 0.99
R5742:Ttc25 UTSW 11 100545873 missense possibly damaging 0.90
R7634:Ttc25 UTSW 11 100561905 critical splice donor site probably null
R7851:Ttc25 UTSW 11 100545829 missense probably damaging 1.00
R8186:Ttc25 UTSW 11 100563679 missense probably benign 0.27
R8194:Ttc25 UTSW 11 100563676 missense probably benign 0.06
R8444:Ttc25 UTSW 11 100561905 critical splice donor site probably null
X0018:Ttc25 UTSW 11 100553598 missense probably damaging 0.99
X0028:Ttc25 UTSW 11 100545898 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAAAATCGGTCCCCTCACTGAG -3'
(R):5'- CCTGTGTCCTGTGAAGGATG -3'

Sequencing Primer
(F):5'- GTGTCCCAGTCCTCAGTGCTG -3'
(R):5'- TCCTGTGAAGGATGGGCGATAAG -3'
Posted On 2021-07-15