Mutagenetix > Incidental Mutation

Incidental Mutation 'R8879:Gm11639'

676787

Institutional Source

Beutler Lab

Gene Symbol

Gm11639

Ensembl Gene

ENSMUSG00000040838

Gene Name

predicted gene 11639

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.091) question?

Stock #

R8879 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104685707-105117394 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 104690955 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 41 (I41T)

Ref Sequence

ENSEMBL: ENSMUSP00000148433 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000148007] [ENSMUST00000212287]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000148007
AA Change: I41T

SMART Domains

Protein: ENSMUSP00000116040
Gene: ENSMUSG00000040838
AA Change: I41T

Domain	Start	End	E-Value	Type
low complexity region	40	55	N/A	INTRINSIC
low complexity region	116	129	N/A	INTRINSIC
internal_repeat_4	146	233	3.42e-6	PROSPERO
internal_repeat_3	165	247	2.21e-6	PROSPERO
low complexity region	331	348	N/A	INTRINSIC
internal_repeat_2	349	361	4.38e-8	PROSPERO
internal_repeat_2	371	383	4.38e-8	PROSPERO
low complexity region	385	640	N/A	INTRINSIC
Pfam:EF-hand_8	677	729	8.7e-6	PFAM
low complexity region	835	842	N/A	INTRINSIC
internal_repeat_1	879	1106	2.47e-14	PROSPERO
internal_repeat_4	1015	1108	3.42e-6	PROSPERO

Predicted Effect

probably benign
Transcript: ENSMUST00000212287
AA Change: I41T

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (69/69)

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130401M01Rik	C	T	15: 58,022,509	V326M	probably damaging	Het
Adap2	T	A	11: 80,156,959	H80Q	probably benign	Het
Ang4	T	C	14: 51,764,486	T2A	probably benign	Het
Arf2	T	C	11: 103,979,759		probably null	Het
B3gnt4	A	G	5: 123,511,148	D192G	probably damaging	Het
BC034090	T	C	1: 155,226,357	I54V	probably benign	Het
Catsper3	A	G	13: 55,804,895	T202A	probably benign	Het
Cenpe	T	A	3: 135,260,101	D2113E	probably damaging	Het
Clasp2	T	C	9: 113,773,705	V191A	probably benign	Het
Col5a1	G	T	2: 28,014,158	A1356S	unknown	Het
Cuzd1	A	G	7: 131,308,848	S573P	probably damaging	Het
Cyp1a2	C	A	9: 57,681,885	M215I	possibly damaging	Het
Dcaf17	T	A	2: 71,063,402	I122K	possibly damaging	Het
Dhcr24	A	G	4: 106,573,809	I232V	probably benign	Het
Dnah10	A	G	5: 124,818,117	E3570G	probably damaging	Het
Dnaja4	A	T	9: 54,714,704		probably benign	Het
Ehd1	A	G	19: 6,298,324	D444G	probably damaging	Het
Ehmt1	T	A	2: 24,836,476	M766L	possibly damaging	Het
Eno4	A	G	19: 58,970,722	I613M	probably benign	Het
Exoc3l	A	T	8: 105,290,549	M602K		Het
Fam107a	C	T	14: 8,301,352		probably null	Het
Frem3	A	T	8: 80,613,148	D690V	probably damaging	Het
Gm19410	A	T	8: 35,771,868	D97V	probably damaging	Het
Grik5	T	A	7: 25,023,064	D540V	possibly damaging	Het
Hint1	T	A	11: 54,869,943	D69E	probably benign	Het
Krt13	T	C	11: 100,119,385	T257A	probably benign	Het
Lpin2	T	C	17: 71,242,754	L676P	probably damaging	Het
Lrguk	A	G	6: 34,029,683	E76G	probably benign	Het
Lrrc8a	A	G	2: 30,256,298	M375V	probably benign	Het
Lrrtm3	T	C	10: 64,089,238	Q50R	possibly damaging	Het
Mmrn1	T	A	6: 60,976,529	L598Q	probably damaging	Het
Mrs2	A	G	13: 25,001,784	I135T	probably damaging	Het
Neb	T	C	2: 52,235,580	D475G		Het
Notch2	A	G	3: 98,135,599	S1427G	possibly damaging	Het
Olfr118	C	A	17: 37,672,411	Y129*	probably null	Het
Olfr682-ps1	A	G	7: 105,126,686	V195A	probably benign	Het
Olfr694	A	T	7: 106,689,089	I214N	probably damaging	Het
Olfr816	A	G	10: 129,911,862	C139R	probably damaging	Het
Olfr952	A	C	9: 39,426,219	V284G	possibly damaging	Het
Opcml	T	C	9: 28,902,151	F246S	probably damaging	Het
Pdzd2	C	A	15: 12,402,319	V729F	probably damaging	Het
Pias2	C	T	18: 77,146,768	Q565*	probably null	Het
Pnp	T	A	14: 50,950,720		probably null	Het
Ptpn18	T	C	1: 34,463,130	S76P	probably benign	Het
Qtrt2	A	T	16: 43,863,197	L304Q	probably damaging	Het
Rad51ap2	A	T	12: 11,457,400	E441V	possibly damaging	Het
Ranbp2	T	A	10: 58,477,889	V1477E	probably benign	Het
Repin1	C	T	6: 48,597,433	T432I	possibly damaging	Het
Rest	G	A	5: 77,282,511	G926R	probably benign	Het
Rnft1	T	A	11: 86,486,690	F143L	possibly damaging	Het
Sema3e	A	T	5: 14,232,094	I415L	probably benign	Het
Slc10a1	T	A	12: 80,967,595	N117I	probably damaging	Het
Slc25a23	G	A	17: 57,059,709		probably benign	Het
Slc2a2	T	C	3: 28,713,802	S160P	possibly damaging	Het
Srrd	A	G	5: 112,338,456	V178A	possibly damaging	Het
Tmigd3	G	T	3: 105,921,961	G198C	probably benign	Het
Trbv29	G	A	6: 41,271,405	M1I	probably null	Het
Tril	A	G	6: 53,819,584	S218P	probably damaging	Het
Trip11	T	C	12: 101,862,598	K1749R	probably benign	Het
Ttc25	G	T	11: 100,566,926	E452*	probably null	Het
Ttn	A	G	2: 76,830,651	V12011A		Het
Ubr4	T	G	4: 139,410,518	F1093V	probably benign	Het
Urb2	C	A	8: 124,028,403	A283E	probably benign	Het
Usp43	T	A	11: 67,898,881		probably benign	Het
Vmn1r28	A	T	6: 58,265,684	I171F	probably benign	Het
Vps33a	G	A	5: 123,533,899	R469W	probably damaging	Het
Zfp202	G	A	9: 40,211,757	R605Q	probably damaging	Het
Zpbp2	A	T	11: 98,554,620	H158L	probably benign	Het

Other mutations in Gm11639

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00897:Gm11639	APN	11	105100021	missense	probably damaging	1.00
IGL01308:Gm11639	APN	11	104720697	missense	probably benign	0.03
IGL01483:Gm11639	APN	11	104739347	missense	probably benign	0.03
IGL01695:Gm11639	APN	11	104736063	missense	probably damaging	1.00
IGL01860:Gm11639	APN	11	104690921	missense	probably benign	0.16
IGL01981:Gm11639	APN	11	104721432	intron	probably benign
IGL01984:Gm11639	APN	11	104738308	missense	probably benign	0.20
IGL02023:Gm11639	APN	11	104721432	intron	probably benign
IGL02252:Gm11639	APN	11	104753927	missense	possibly damaging	0.68
IGL02886:Gm11639	APN	11	105095874	missense	possibly damaging	0.95
IGL03116:Gm11639	APN	11	104721533	missense	probably benign	0.02
IGL03141:Gm11639	APN	11	105095870	missense	probably damaging	0.99
IGL03242:Gm11639	APN	11	105106404	missense	probably damaging	1.00
IGL03274:Gm11639	APN	11	104721093	missense	probably benign	0.03
IGL03408:Gm11639	APN	11	104710621	missense	probably benign	0.03
R0018:Gm11639	UTSW	11	104721552	critical splice donor site	probably null
R0068:Gm11639	UTSW	11	104720822	missense	probably benign	0.29
R0350:Gm11639	UTSW	11	104690880	missense	probably benign	0.03
R0646:Gm11639	UTSW	11	104720501	missense	probably benign	0.03
R0668:Gm11639	UTSW	11	104720492	missense	probably benign	0.16
R0715:Gm11639	UTSW	11	104720880	missense	possibly damaging	0.90
R0944:Gm11639	UTSW	11	104710730	splice site	probably null
R1330:Gm11639	UTSW	11	104746290	missense	possibly damaging	0.84
R1508:Gm11639	UTSW	11	104710677	missense	probably benign	0.03
R1643:Gm11639	UTSW	11	104698978	missense	probably benign	0.16
R1651:Gm11639	UTSW	11	104720666	missense	probably benign	0.03
R1665:Gm11639	UTSW	11	104721114	missense	probably benign	0.07
R1702:Gm11639	UTSW	11	104691006	missense	probably benign	0.03
R1711:Gm11639	UTSW	11	104720688	missense	probably benign	0.07
R1779:Gm11639	UTSW	11	104720939	missense	probably benign	0.15
R1813:Gm11639	UTSW	11	104720688	missense	probably benign	0.07
R1818:Gm11639	UTSW	11	104721507	missense	probably benign	0.10
R1896:Gm11639	UTSW	11	104720688	missense	probably benign	0.07
R1969:Gm11639	UTSW	11	104746264	missense	probably damaging	1.00
R2139:Gm11639	UTSW	11	104751911	missense	possibly damaging	0.53
R2165:Gm11639	UTSW	11	104751862	missense	possibly damaging	0.93
R2359:Gm11639	UTSW	11	104739280	missense	possibly damaging	0.80
R2394:Gm11639	UTSW	11	104738295	missense	probably benign	0.17
R2406:Gm11639	UTSW	11	104720631	missense	probably benign	0.03
R2570:Gm11639	UTSW	11	104733664	missense	probably damaging	1.00
R3795:Gm11639	UTSW	11	104733675	missense	possibly damaging	0.94
R4352:Gm11639	UTSW	11	104739314	missense	probably null	0.25
R4359:Gm11639	UTSW	11	104733721	splice site	probably null
R4424:Gm11639	UTSW	11	104736114	critical splice donor site	probably null
R4895:Gm11639	UTSW	11	104720286	missense	probably benign	0.16
R4895:Gm11639	UTSW	11	104749670	missense	probably damaging	1.00
R5006:Gm11639	UTSW	11	104729677	splice site	probably null
R5066:Gm11639	UTSW	11	104720664	missense	probably benign	0.03
R5329:Gm11639	UTSW	11	104753806	splice site	probably null
R5405:Gm11639	UTSW	11	104721192	missense	probably benign	0.07
R5814:Gm11639	UTSW	11	104736114	critical splice donor site	probably benign
R5888:Gm11639	UTSW	11	104721401	splice site	probably benign
R5910:Gm11639	UTSW	11	104690934	missense	probably benign	0.01
R5975:Gm11639	UTSW	11	104687549	start gained	probably benign
R6019:Gm11639	UTSW	11	105042902	critical splice donor site	probably null
R6028:Gm11639	UTSW	11	104769655	critical splice donor site	probably null
R6048:Gm11639	UTSW	11	104944433	missense	unknown
R6059:Gm11639	UTSW	11	105036769	missense	probably benign	0.03
R6147:Gm11639	UTSW	11	104967740	missense	unknown
R6176:Gm11639	UTSW	11	104792557	missense	probably benign	0.16
R6181:Gm11639	UTSW	11	104831333	missense	probably benign	0.25
R6196:Gm11639	UTSW	11	104855560	missense	probably benign	0.07
R6245:Gm11639	UTSW	11	104785008	missense	probably benign	0.03
R6262:Gm11639	UTSW	11	104893753	missense	probably benign	0.24
R6263:Gm11639	UTSW	11	104919486	missense	unknown
R6277:Gm11639	UTSW	11	105010322	missense	possibly damaging	0.49
R6338:Gm11639	UTSW	11	104843208	nonsense	probably null
R6355:Gm11639	UTSW	11	105005685	missense	probably benign	0.29
R6356:Gm11639	UTSW	11	104893707	missense	probably benign	0.19
R6365:Gm11639	UTSW	11	104924586	missense	unknown
R6391:Gm11639	UTSW	11	104994317	missense	possibly damaging	0.92
R6556:Gm11639	UTSW	11	105008251	missense	probably null	0.03
R6604:Gm11639	UTSW	11	104698946	nonsense	probably null
R6605:Gm11639	UTSW	11	104999281	splice site	probably null
R6634:Gm11639	UTSW	11	104893783	missense	probably benign	0.17
R6851:Gm11639	UTSW	11	105005695	missense	probably benign	0.03
R6862:Gm11639	UTSW	11	104721458	nonsense	probably null
R6949:Gm11639	UTSW	11	104909070	missense	probably damaging	1.00
R6970:Gm11639	UTSW	11	104776356	missense	probably benign	0.03
R7014:Gm11639	UTSW	11	104693422	missense	probably benign	0.03
R7097:Gm11639	UTSW	11	105008961	missense	possibly damaging	0.68
R7122:Gm11639	UTSW	11	105008961	missense	possibly damaging	0.68
R7124:Gm11639	UTSW	11	104738274	missense	probably benign	0.17
R7146:Gm11639	UTSW	11	104967752	missense	unknown
R7146:Gm11639	UTSW	11	105022938	missense	probably benign	0.03
R7154:Gm11639	UTSW	11	104699140	splice site	probably null
R7175:Gm11639	UTSW	11	104947411	missense	unknown
R7198:Gm11639	UTSW	11	104751885	missense	probably benign	0.15
R7211:Gm11639	UTSW	11	104710713	missense	probably benign	0.01
R7211:Gm11639	UTSW	11	104724609	critical splice donor site	probably null
R7216:Gm11639	UTSW	11	104880549	missense	possibly damaging	0.49
R7221:Gm11639	UTSW	11	104900606	missense	probably benign	0.36
R7233:Gm11639	UTSW	11	104839843	missense	possibly damaging	0.69
R7236:Gm11639	UTSW	11	104899267	missense	probably benign	0.10
R7262:Gm11639	UTSW	11	104854606	critical splice donor site	probably null
R7289:Gm11639	UTSW	11	105038358	missense	probably benign	0.24
R7323:Gm11639	UTSW	11	105030011	missense	probably benign	0.07
R7378:Gm11639	UTSW	11	104714702	missense	probably benign	0.03
R7388:Gm11639	UTSW	11	104721045	missense	probably damaging	0.97
R7390:Gm11639	UTSW	11	104724585	missense	possibly damaging	0.46
R7411:Gm11639	UTSW	11	104999723	missense	probably benign	0.10
R7468:Gm11639	UTSW	11	104749700	missense	probably benign	0.17
R7497:Gm11639	UTSW	11	104762690	critical splice donor site	probably null
R7620:Gm11639	UTSW	11	104832143	missense	possibly damaging	0.95
R7638:Gm11639	UTSW	11	105036799	missense	probably benign	0.03
R7661:Gm11639	UTSW	11	104726677	missense	probably benign	0.03
R7667:Gm11639	UTSW	11	104751911	missense	possibly damaging	0.53
R7682:Gm11639	UTSW	11	104964348	splice site	probably null
R7708:Gm11639	UTSW	11	104964571	missense	unknown
R7721:Gm11639	UTSW	11	104724540	nonsense	probably null
R7747:Gm11639	UTSW	11	104842603	missense	probably damaging	0.96
R7840:Gm11639	UTSW	11	104733713	missense	probably benign	0.07
R7846:Gm11639	UTSW	11	104714745	critical splice donor site	probably null
R7893:Gm11639	UTSW	11	104979360	missense	unknown
R7897:Gm11639	UTSW	11	104998235	missense	probably benign	0.24
R7936:Gm11639	UTSW	11	104999698	missense	possibly damaging	0.89
R7936:Gm11639	UTSW	11	105046559	critical splice donor site	probably null
R7959:Gm11639	UTSW	11	105042801	missense	probably damaging	0.96
R8031:Gm11639	UTSW	11	104881469	missense	possibly damaging	0.49
R8041:Gm11639	UTSW	11	104919479	missense	unknown
R8054:Gm11639	UTSW	11	104730400	missense	probably benign	0.07
R8056:Gm11639	UTSW	11	104909070	missense	probably damaging	0.98
R8088:Gm11639	UTSW	11	104998246	missense	probably benign	0.10
R8112:Gm11639	UTSW	11	104950200	missense	unknown
R8340:Gm11639	UTSW	11	104986030	missense	unknown
R8405:Gm11639	UTSW	11	104721198	missense	probably benign	0.02
R8413:Gm11639	UTSW	11	104920309	missense	unknown
R8472:Gm11639	UTSW	11	104818637	missense	probably benign	0.07
R8549:Gm11639	UTSW	11	104999695	missense	probably damaging	0.99
R8699:Gm11639	UTSW	11	104781246	missense	probably benign	0.03
R8711:Gm11639	UTSW	11	104852545	missense	probably benign	0.03
R8732:Gm11639	UTSW	11	104804274	missense	probably benign	0.03
R8745:Gm11639	UTSW	11	104858478	missense	possibly damaging	0.57
R8806:Gm11639	UTSW	11	105037869	missense	probably benign	0.07
R8810:Gm11639	UTSW	11	104914895	missense	unknown
R8845:Gm11639	UTSW	11	105008961	missense	possibly damaging	0.68
R8870:Gm11639	UTSW	11	104900674	missense	probably benign	0.07
R8872:Gm11639	UTSW	11	104870054	missense	probably benign	0.19
R8924:Gm11639	UTSW	11	104915427	frame shift	probably null
R8954:Gm11639	UTSW	11	105018699	critical splice donor site	probably null
R8960:Gm11639	UTSW	11	104929946	splice site	probably benign
R8975:Gm11639	UTSW	11	105063589	missense	probably benign	0.17
R8988:Gm11639	UTSW	11	105020526	missense	probably benign	0.07
R8998:Gm11639	UTSW	11	104749651	missense	probably benign	0.09
R8999:Gm11639	UTSW	11	104749651	missense	probably benign	0.09
R9002:Gm11639	UTSW	11	105029996	missense	probably damaging	0.99
R9012:Gm11639	UTSW	11	104820521	critical splice donor site	probably null
R9036:Gm11639	UTSW	11	105036775	missense	probably benign	0.03
R9037:Gm11639	UTSW	11	104912965	missense	unknown
R9059:Gm11639	UTSW	11	104751863	missense	possibly damaging	0.73
R9066:Gm11639	UTSW	11	104740862	intron	probably benign
R9122:Gm11639	UTSW	11	104965779	missense	unknown
R9125:Gm11639	UTSW	11	104845534	missense	probably damaging	1.00
R9127:Gm11639	UTSW	11	104850581	missense	probably benign	0.07
R9171:Gm11639	UTSW	11	104909882	missense	probably benign	0.36
R9219:Gm11639	UTSW	11	104945865	missense	unknown
R9224:Gm11639	UTSW	11	104770975	missense	probably benign	0.07
R9235:Gm11639	UTSW	11	105017161	missense	probably benign	0.19
R9294:Gm11639	UTSW	11	104831300	missense	probably benign	0.24
R9318:Gm11639	UTSW	11	104965822	critical splice donor site	probably null
R9322:Gm11639	UTSW	11	104874373	missense	probably benign	0.36
R9361:Gm11639	UTSW	11	105005698	missense	probably benign	0.03
R9408:Gm11639	UTSW	11	104730429	critical splice donor site	probably null
R9434:Gm11639	UTSW	11	105009037	missense	probably benign	0.24
R9477:Gm11639	UTSW	11	104945872	missense	unknown
R9658:Gm11639	UTSW	11	104720294	missense	probably benign	0.03
R9719:Gm11639	UTSW	11	104977086	missense	unknown
R9751:Gm11639	UTSW	11	104893085	missense	probably benign	0.19
R9763:Gm11639	UTSW	11	104999659	missense	possibly damaging	0.89
X0026:Gm11639	UTSW	11	104720975	missense	probably benign	0.07
Z1088:Gm11639	UTSW	11	104751902	missense	probably damaging	0.96
Z1176:Gm11639	UTSW	11	105001967	missense	probably benign	0.29
Z1177:Gm11639	UTSW	11	104739338	nonsense	probably null
Z1177:Gm11639	UTSW	11	104820518	missense	probably benign	0.03
Z1177:Gm11639	UTSW	11	104924019	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ACCTGTAACAAGGCTGAGTGC -3'
(R):5'- CCGTGTTCCTAACAGAATGACC -3'

Sequencing Primer
(F):5'- CATGGACCATGCCTTAGGTTTGTATC -3'
(R):5'- GTGTTCCTAACAGAATGACCACAAC -3'

Posted On

2021-07-15