Incidental Mutation 'R8879:Efcab3'
ID 676787
Institutional Source Beutler Lab
Gene Symbol Efcab3
Ensembl Gene ENSMUSG00000020690
Gene Name EF-hand calcium binding domain 3
Synonyms Gm11639, Efcab13, 4921510J17Rik, Efcab15, Gm11639
MMRRC Submission 068747-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8879 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 104954418-105008363 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 104581781 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 41 (I41T)
Ref Sequence ENSEMBL: ENSMUSP00000148433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000148007] [ENSMUST00000212287]
AlphaFold Q80X60
Predicted Effect unknown
Transcript: ENSMUST00000148007
AA Change: I41T
SMART Domains Protein: ENSMUSP00000116040
Gene: ENSMUSG00000040838
AA Change: I41T

DomainStartEndE-ValueType
low complexity region 40 55 N/A INTRINSIC
low complexity region 116 129 N/A INTRINSIC
internal_repeat_4 146 233 3.42e-6 PROSPERO
internal_repeat_3 165 247 2.21e-6 PROSPERO
low complexity region 331 348 N/A INTRINSIC
internal_repeat_2 349 361 4.38e-8 PROSPERO
internal_repeat_2 371 383 4.38e-8 PROSPERO
low complexity region 385 640 N/A INTRINSIC
Pfam:EF-hand_8 677 729 8.7e-6 PFAM
low complexity region 835 842 N/A INTRINSIC
internal_repeat_1 879 1106 2.47e-14 PROSPERO
internal_repeat_4 1015 1108 3.42e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000212287
AA Change: I41T

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C T 15: 57,885,905 (GRCm39) V326M probably damaging Het
Adap2 T A 11: 80,047,785 (GRCm39) H80Q probably benign Het
Ang4 T C 14: 52,001,943 (GRCm39) T2A probably benign Het
Arf2 T C 11: 103,870,585 (GRCm39) probably null Het
B3gnt4 A G 5: 123,649,211 (GRCm39) D192G probably damaging Het
BC034090 T C 1: 155,102,103 (GRCm39) I54V probably benign Het
Catsper3 A G 13: 55,952,708 (GRCm39) T202A probably benign Het
Cenpe T A 3: 134,965,862 (GRCm39) D2113E probably damaging Het
Clasp2 T C 9: 113,602,773 (GRCm39) V191A probably benign Het
Col5a1 G T 2: 27,904,170 (GRCm39) A1356S unknown Het
Cuzd1 A G 7: 130,910,577 (GRCm39) S573P probably damaging Het
Cyp1a2 C A 9: 57,589,168 (GRCm39) M215I possibly damaging Het
Dcaf17 T A 2: 70,893,746 (GRCm39) I122K possibly damaging Het
Dhcr24 A G 4: 106,431,006 (GRCm39) I232V probably benign Het
Dnah10 A G 5: 124,895,181 (GRCm39) E3570G probably damaging Het
Dnaja4 A T 9: 54,621,988 (GRCm39) probably benign Het
Ehd1 A G 19: 6,348,354 (GRCm39) D444G probably damaging Het
Ehmt1 T A 2: 24,726,488 (GRCm39) M766L possibly damaging Het
Eno4 A G 19: 58,959,154 (GRCm39) I613M probably benign Het
Exoc3l A T 8: 106,017,181 (GRCm39) M602K Het
Fam107a C T 14: 8,301,352 (GRCm38) probably null Het
Frem3 A T 8: 81,339,777 (GRCm39) D690V probably damaging Het
Gm19410 A T 8: 36,239,022 (GRCm39) D97V probably damaging Het
Grik5 T A 7: 24,722,489 (GRCm39) D540V possibly damaging Het
Hint1 T A 11: 54,760,769 (GRCm39) D69E probably benign Het
Krt13 T C 11: 100,010,211 (GRCm39) T257A probably benign Het
Lpin2 T C 17: 71,549,749 (GRCm39) L676P probably damaging Het
Lrguk A G 6: 34,006,618 (GRCm39) E76G probably benign Het
Lrrc8a A G 2: 30,146,310 (GRCm39) M375V probably benign Het
Lrrtm3 T C 10: 63,925,017 (GRCm39) Q50R possibly damaging Het
Mmrn1 T A 6: 60,953,513 (GRCm39) L598Q probably damaging Het
Mrs2 A G 13: 25,185,767 (GRCm39) I135T probably damaging Het
Neb T C 2: 52,125,592 (GRCm39) D475G Het
Notch2 A G 3: 98,042,915 (GRCm39) S1427G possibly damaging Het
Odad4 G T 11: 100,457,752 (GRCm39) E452* probably null Het
Opcml T C 9: 28,813,447 (GRCm39) F246S probably damaging Het
Or10al2 C A 17: 37,983,302 (GRCm39) Y129* probably null Het
Or2ag1b A T 7: 106,288,296 (GRCm39) I214N probably damaging Het
Or56a42-ps1 A G 7: 104,775,893 (GRCm39) V195A probably benign Het
Or6c69 A G 10: 129,747,731 (GRCm39) C139R probably damaging Het
Or8g33 A C 9: 39,337,515 (GRCm39) V284G possibly damaging Het
Pdzd2 C A 15: 12,402,405 (GRCm39) V729F probably damaging Het
Pias2 C T 18: 77,234,464 (GRCm39) Q565* probably null Het
Pnp T A 14: 51,188,177 (GRCm39) probably null Het
Ptpn18 T C 1: 34,502,211 (GRCm39) S76P probably benign Het
Qtrt2 A T 16: 43,683,560 (GRCm39) L304Q probably damaging Het
Rad51ap2 A T 12: 11,507,401 (GRCm39) E441V possibly damaging Het
Ranbp2 T A 10: 58,313,711 (GRCm39) V1477E probably benign Het
Repin1 C T 6: 48,574,367 (GRCm39) T432I possibly damaging Het
Rest G A 5: 77,430,358 (GRCm39) G926R probably benign Het
Rnft1 T A 11: 86,377,516 (GRCm39) F143L possibly damaging Het
Sema3e A T 5: 14,282,108 (GRCm39) I415L probably benign Het
Slc10a1 T A 12: 81,014,369 (GRCm39) N117I probably damaging Het
Slc25a23 G A 17: 57,366,709 (GRCm39) probably benign Het
Slc2a2 T C 3: 28,767,951 (GRCm39) S160P possibly damaging Het
Srrd A G 5: 112,486,322 (GRCm39) V178A possibly damaging Het
Tmigd3 G T 3: 105,829,277 (GRCm39) G198C probably benign Het
Trbv28 G A 6: 41,248,339 (GRCm39) M1I probably null Het
Tril A G 6: 53,796,569 (GRCm39) S218P probably damaging Het
Trip11 T C 12: 101,828,857 (GRCm39) K1749R probably benign Het
Ttn A G 2: 76,660,995 (GRCm39) V12011A Het
Ubr4 T G 4: 139,137,829 (GRCm39) F1093V probably benign Het
Urb2 C A 8: 124,755,142 (GRCm39) A283E probably benign Het
Usp43 T A 11: 67,789,707 (GRCm39) probably benign Het
Vmn1r28 A T 6: 58,242,669 (GRCm39) I171F probably benign Het
Vps33a G A 5: 123,671,962 (GRCm39) R469W probably damaging Het
Zfp202 G A 9: 40,123,053 (GRCm39) R605Q probably damaging Het
Zpbp2 A T 11: 98,445,446 (GRCm39) H158L probably benign Het
Other mutations in Efcab3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Efcab3 APN 11 104,990,847 (GRCm39) missense probably damaging 1.00
IGL01308:Efcab3 APN 11 104,611,523 (GRCm39) missense probably benign 0.03
IGL01483:Efcab3 APN 11 104,630,173 (GRCm39) missense probably benign 0.03
IGL01695:Efcab3 APN 11 104,626,889 (GRCm39) missense probably damaging 1.00
IGL01860:Efcab3 APN 11 104,581,747 (GRCm39) missense probably benign 0.16
IGL01981:Efcab3 APN 11 104,612,258 (GRCm39) intron probably benign
IGL01984:Efcab3 APN 11 104,629,134 (GRCm39) missense probably benign 0.20
IGL02023:Efcab3 APN 11 104,612,258 (GRCm39) intron probably benign
IGL02252:Efcab3 APN 11 104,644,753 (GRCm39) missense possibly damaging 0.68
IGL02886:Efcab3 APN 11 104,986,700 (GRCm39) missense possibly damaging 0.95
IGL03116:Efcab3 APN 11 104,612,359 (GRCm39) missense probably benign 0.02
IGL03141:Efcab3 APN 11 104,986,696 (GRCm39) missense probably damaging 0.99
IGL03242:Efcab3 APN 11 104,997,230 (GRCm39) missense probably damaging 1.00
IGL03274:Efcab3 APN 11 104,611,919 (GRCm39) missense probably benign 0.03
IGL03408:Efcab3 APN 11 104,601,447 (GRCm39) missense probably benign 0.03
PIT4812001:Efcab3 UTSW 11 104,990,805 (GRCm39) missense probably null 0.00
R0018:Efcab3 UTSW 11 104,612,378 (GRCm39) critical splice donor site probably null
R0068:Efcab3 UTSW 11 104,611,648 (GRCm39) missense probably benign 0.29
R0350:Efcab3 UTSW 11 104,581,706 (GRCm39) missense probably benign 0.03
R0388:Efcab3 UTSW 11 105,000,227 (GRCm39) missense possibly damaging 0.61
R0646:Efcab3 UTSW 11 104,611,327 (GRCm39) missense probably benign 0.03
R0668:Efcab3 UTSW 11 104,611,318 (GRCm39) missense probably benign 0.16
R0715:Efcab3 UTSW 11 104,611,706 (GRCm39) missense possibly damaging 0.90
R0944:Efcab3 UTSW 11 104,601,556 (GRCm39) splice site probably null
R1330:Efcab3 UTSW 11 104,637,116 (GRCm39) missense possibly damaging 0.84
R1440:Efcab3 UTSW 11 104,999,581 (GRCm39) splice site probably benign
R1508:Efcab3 UTSW 11 104,601,503 (GRCm39) missense probably benign 0.03
R1540:Efcab3 UTSW 11 104,999,726 (GRCm39) missense probably benign 0.07
R1643:Efcab3 UTSW 11 104,589,804 (GRCm39) missense probably benign 0.16
R1651:Efcab3 UTSW 11 104,611,492 (GRCm39) missense probably benign 0.03
R1665:Efcab3 UTSW 11 104,611,940 (GRCm39) missense probably benign 0.07
R1702:Efcab3 UTSW 11 104,581,832 (GRCm39) missense probably benign 0.03
R1711:Efcab3 UTSW 11 104,611,514 (GRCm39) missense probably benign 0.07
R1779:Efcab3 UTSW 11 104,611,765 (GRCm39) missense probably benign 0.15
R1813:Efcab3 UTSW 11 104,611,514 (GRCm39) missense probably benign 0.07
R1818:Efcab3 UTSW 11 104,612,333 (GRCm39) missense probably benign 0.10
R1896:Efcab3 UTSW 11 104,611,514 (GRCm39) missense probably benign 0.07
R1969:Efcab3 UTSW 11 104,637,090 (GRCm39) missense probably damaging 1.00
R2029:Efcab3 UTSW 11 104,990,851 (GRCm39) missense probably damaging 0.99
R2139:Efcab3 UTSW 11 104,642,737 (GRCm39) missense possibly damaging 0.53
R2165:Efcab3 UTSW 11 104,642,688 (GRCm39) missense possibly damaging 0.93
R2359:Efcab3 UTSW 11 104,630,106 (GRCm39) missense possibly damaging 0.80
R2394:Efcab3 UTSW 11 104,629,121 (GRCm39) missense probably benign 0.17
R2401:Efcab3 UTSW 11 104,963,144 (GRCm39) critical splice donor site probably null
R2406:Efcab3 UTSW 11 104,611,457 (GRCm39) missense probably benign 0.03
R2570:Efcab3 UTSW 11 104,624,490 (GRCm39) missense probably damaging 1.00
R3795:Efcab3 UTSW 11 104,624,501 (GRCm39) missense possibly damaging 0.94
R3901:Efcab3 UTSW 11 104,974,713 (GRCm39) missense possibly damaging 0.68
R4244:Efcab3 UTSW 11 105,002,629 (GRCm39) missense probably damaging 1.00
R4352:Efcab3 UTSW 11 104,630,140 (GRCm39) missense probably null 0.25
R4359:Efcab3 UTSW 11 104,624,547 (GRCm39) splice site probably null
R4424:Efcab3 UTSW 11 104,626,940 (GRCm39) critical splice donor site probably null
R4895:Efcab3 UTSW 11 105,008,227 (GRCm39) unclassified probably benign
R4895:Efcab3 UTSW 11 104,640,496 (GRCm39) missense probably damaging 1.00
R4895:Efcab3 UTSW 11 104,611,112 (GRCm39) missense probably benign 0.16
R5006:Efcab3 UTSW 11 104,620,503 (GRCm39) splice site probably null
R5066:Efcab3 UTSW 11 104,611,490 (GRCm39) missense probably benign 0.03
R5316:Efcab3 UTSW 11 104,967,286 (GRCm39) missense possibly damaging 0.80
R5329:Efcab3 UTSW 11 104,644,632 (GRCm39) splice site probably null
R5405:Efcab3 UTSW 11 104,612,018 (GRCm39) missense probably benign 0.07
R5814:Efcab3 UTSW 11 104,626,940 (GRCm39) critical splice donor site probably benign
R5888:Efcab3 UTSW 11 104,612,227 (GRCm39) splice site probably benign
R5910:Efcab3 UTSW 11 104,581,760 (GRCm39) missense probably benign 0.01
R5975:Efcab3 UTSW 11 104,578,375 (GRCm39) start gained probably benign
R6019:Efcab3 UTSW 11 104,933,728 (GRCm39) critical splice donor site probably null
R6028:Efcab3 UTSW 11 104,660,481 (GRCm39) critical splice donor site probably null
R6048:Efcab3 UTSW 11 104,835,259 (GRCm39) missense unknown
R6059:Efcab3 UTSW 11 104,927,595 (GRCm39) missense probably benign 0.03
R6147:Efcab3 UTSW 11 104,858,566 (GRCm39) missense unknown
R6176:Efcab3 UTSW 11 104,683,383 (GRCm39) missense probably benign 0.16
R6181:Efcab3 UTSW 11 104,722,159 (GRCm39) missense probably benign 0.25
R6196:Efcab3 UTSW 11 104,746,386 (GRCm39) missense probably benign 0.07
R6245:Efcab3 UTSW 11 104,675,834 (GRCm39) missense probably benign 0.03
R6262:Efcab3 UTSW 11 104,784,579 (GRCm39) missense probably benign 0.24
R6263:Efcab3 UTSW 11 104,810,312 (GRCm39) missense unknown
R6277:Efcab3 UTSW 11 104,901,148 (GRCm39) missense possibly damaging 0.49
R6338:Efcab3 UTSW 11 104,734,034 (GRCm39) nonsense probably null
R6355:Efcab3 UTSW 11 104,896,511 (GRCm39) missense probably benign 0.29
R6356:Efcab3 UTSW 11 104,784,533 (GRCm39) missense probably benign 0.19
R6365:Efcab3 UTSW 11 104,815,412 (GRCm39) missense unknown
R6378:Efcab3 UTSW 11 104,999,620 (GRCm39) missense possibly damaging 0.83
R6391:Efcab3 UTSW 11 104,885,143 (GRCm39) missense possibly damaging 0.92
R6494:Efcab3 UTSW 11 104,990,845 (GRCm39) missense possibly damaging 0.93
R6556:Efcab3 UTSW 11 104,899,077 (GRCm39) missense probably null 0.03
R6573:Efcab3 UTSW 11 104,971,461 (GRCm39) missense possibly damaging 0.91
R6604:Efcab3 UTSW 11 104,589,772 (GRCm39) nonsense probably null
R6605:Efcab3 UTSW 11 104,890,107 (GRCm39) splice site probably null
R6634:Efcab3 UTSW 11 104,784,609 (GRCm39) missense probably benign 0.17
R6723:Efcab3 UTSW 11 105,007,906 (GRCm39) missense possibly damaging 0.95
R6851:Efcab3 UTSW 11 104,896,521 (GRCm39) missense probably benign 0.03
R6862:Efcab3 UTSW 11 104,612,284 (GRCm39) nonsense probably null
R6949:Efcab3 UTSW 11 104,799,896 (GRCm39) missense probably damaging 1.00
R6970:Efcab3 UTSW 11 104,667,182 (GRCm39) missense probably benign 0.03
R7014:Efcab3 UTSW 11 104,584,248 (GRCm39) missense probably benign 0.03
R7097:Efcab3 UTSW 11 104,899,787 (GRCm39) missense possibly damaging 0.68
R7122:Efcab3 UTSW 11 104,899,787 (GRCm39) missense possibly damaging 0.68
R7124:Efcab3 UTSW 11 104,629,100 (GRCm39) missense probably benign 0.17
R7146:Efcab3 UTSW 11 104,913,764 (GRCm39) missense probably benign 0.03
R7146:Efcab3 UTSW 11 104,858,578 (GRCm39) missense unknown
R7154:Efcab3 UTSW 11 104,589,966 (GRCm39) splice site probably null
R7175:Efcab3 UTSW 11 104,838,237 (GRCm39) missense unknown
R7189:Efcab3 UTSW 11 104,986,690 (GRCm39) missense probably benign
R7198:Efcab3 UTSW 11 104,642,711 (GRCm39) missense probably benign 0.15
R7211:Efcab3 UTSW 11 104,601,539 (GRCm39) missense probably benign 0.01
R7211:Efcab3 UTSW 11 104,615,435 (GRCm39) critical splice donor site probably null
R7216:Efcab3 UTSW 11 104,771,375 (GRCm39) missense possibly damaging 0.49
R7221:Efcab3 UTSW 11 104,791,432 (GRCm39) missense probably benign 0.36
R7233:Efcab3 UTSW 11 104,730,669 (GRCm39) missense possibly damaging 0.69
R7236:Efcab3 UTSW 11 104,790,093 (GRCm39) missense probably benign 0.10
R7262:Efcab3 UTSW 11 104,745,432 (GRCm39) critical splice donor site probably null
R7289:Efcab3 UTSW 11 104,929,184 (GRCm39) missense probably benign 0.24
R7323:Efcab3 UTSW 11 104,920,837 (GRCm39) missense probably benign 0.07
R7378:Efcab3 UTSW 11 104,605,528 (GRCm39) missense probably benign 0.03
R7388:Efcab3 UTSW 11 104,611,871 (GRCm39) missense probably damaging 0.97
R7390:Efcab3 UTSW 11 104,615,411 (GRCm39) missense possibly damaging 0.46
R7411:Efcab3 UTSW 11 104,890,549 (GRCm39) missense probably benign 0.10
R7468:Efcab3 UTSW 11 104,640,526 (GRCm39) missense probably benign 0.17
R7483:Efcab3 UTSW 11 105,000,112 (GRCm39) missense probably benign 0.39
R7497:Efcab3 UTSW 11 104,653,516 (GRCm39) critical splice donor site probably null
R7612:Efcab3 UTSW 11 104,999,647 (GRCm39) missense possibly damaging 0.80
R7620:Efcab3 UTSW 11 104,722,969 (GRCm39) missense possibly damaging 0.95
R7638:Efcab3 UTSW 11 104,927,625 (GRCm39) missense probably benign 0.03
R7661:Efcab3 UTSW 11 104,617,503 (GRCm39) missense probably benign 0.03
R7667:Efcab3 UTSW 11 104,642,737 (GRCm39) missense possibly damaging 0.53
R7682:Efcab3 UTSW 11 104,855,174 (GRCm39) splice site probably null
R7708:Efcab3 UTSW 11 104,855,397 (GRCm39) missense unknown
R7719:Efcab3 UTSW 11 105,002,674 (GRCm39) missense probably benign 0.14
R7721:Efcab3 UTSW 11 104,615,366 (GRCm39) nonsense probably null
R7735:Efcab3 UTSW 11 104,962,465 (GRCm39) missense probably benign
R7747:Efcab3 UTSW 11 104,733,429 (GRCm39) missense probably damaging 0.96
R7840:Efcab3 UTSW 11 104,624,539 (GRCm39) missense probably benign 0.07
R7846:Efcab3 UTSW 11 104,605,571 (GRCm39) critical splice donor site probably null
R7893:Efcab3 UTSW 11 104,870,186 (GRCm39) missense unknown
R7895:Efcab3 UTSW 11 105,008,150 (GRCm39) missense probably benign 0.29
R7897:Efcab3 UTSW 11 104,889,061 (GRCm39) missense probably benign 0.24
R7936:Efcab3 UTSW 11 104,890,524 (GRCm39) missense possibly damaging 0.89
R7936:Efcab3 UTSW 11 104,937,385 (GRCm39) critical splice donor site probably null
R7959:Efcab3 UTSW 11 104,933,627 (GRCm39) missense probably damaging 0.96
R8031:Efcab3 UTSW 11 104,772,295 (GRCm39) missense possibly damaging 0.49
R8041:Efcab3 UTSW 11 104,810,305 (GRCm39) missense unknown
R8054:Efcab3 UTSW 11 104,621,226 (GRCm39) missense probably benign 0.07
R8056:Efcab3 UTSW 11 104,799,896 (GRCm39) missense probably damaging 0.98
R8061:Efcab3 UTSW 11 104,997,275 (GRCm39) missense probably benign 0.00
R8088:Efcab3 UTSW 11 104,889,072 (GRCm39) missense probably benign 0.10
R8112:Efcab3 UTSW 11 104,841,026 (GRCm39) missense unknown
R8116:Efcab3 UTSW 11 105,002,677 (GRCm39) missense possibly damaging 0.65
R8340:Efcab3 UTSW 11 104,876,856 (GRCm39) missense unknown
R8405:Efcab3 UTSW 11 104,612,024 (GRCm39) missense probably benign 0.02
R8413:Efcab3 UTSW 11 104,811,135 (GRCm39) missense unknown
R8472:Efcab3 UTSW 11 104,709,463 (GRCm39) missense probably benign 0.07
R8549:Efcab3 UTSW 11 104,890,521 (GRCm39) missense probably damaging 0.99
R8699:Efcab3 UTSW 11 104,672,072 (GRCm39) missense probably benign 0.03
R8711:Efcab3 UTSW 11 104,743,371 (GRCm39) missense probably benign 0.03
R8732:Efcab3 UTSW 11 104,695,100 (GRCm39) missense probably benign 0.03
R8745:Efcab3 UTSW 11 104,749,304 (GRCm39) missense possibly damaging 0.57
R8806:Efcab3 UTSW 11 104,928,695 (GRCm39) missense probably benign 0.07
R8810:Efcab3 UTSW 11 104,805,721 (GRCm39) missense unknown
R8845:Efcab3 UTSW 11 104,899,787 (GRCm39) missense possibly damaging 0.68
R8870:Efcab3 UTSW 11 104,791,500 (GRCm39) missense probably benign 0.07
R8872:Efcab3 UTSW 11 104,760,880 (GRCm39) missense probably benign 0.19
R8924:Efcab3 UTSW 11 104,806,253 (GRCm39) frame shift probably null
R8954:Efcab3 UTSW 11 104,909,525 (GRCm39) critical splice donor site probably null
R8960:Efcab3 UTSW 11 104,820,772 (GRCm39) splice site probably benign
R8975:Efcab3 UTSW 11 104,954,415 (GRCm39) missense probably benign 0.17
R8988:Efcab3 UTSW 11 104,911,352 (GRCm39) missense probably benign 0.07
R8998:Efcab3 UTSW 11 104,640,477 (GRCm39) missense probably benign 0.09
R8999:Efcab3 UTSW 11 104,640,477 (GRCm39) missense probably benign 0.09
R9002:Efcab3 UTSW 11 104,920,822 (GRCm39) missense probably damaging 0.99
R9012:Efcab3 UTSW 11 104,711,347 (GRCm39) critical splice donor site probably null
R9036:Efcab3 UTSW 11 104,927,601 (GRCm39) missense probably benign 0.03
R9037:Efcab3 UTSW 11 104,803,791 (GRCm39) missense unknown
R9059:Efcab3 UTSW 11 104,642,689 (GRCm39) missense possibly damaging 0.73
R9066:Efcab3 UTSW 11 104,631,688 (GRCm39) intron probably benign
R9122:Efcab3 UTSW 11 104,856,605 (GRCm39) missense unknown
R9125:Efcab3 UTSW 11 104,736,360 (GRCm39) missense probably damaging 1.00
R9127:Efcab3 UTSW 11 104,741,407 (GRCm39) missense probably benign 0.07
R9171:Efcab3 UTSW 11 104,800,708 (GRCm39) missense probably benign 0.36
R9219:Efcab3 UTSW 11 104,836,691 (GRCm39) missense unknown
R9224:Efcab3 UTSW 11 104,661,801 (GRCm39) missense probably benign 0.07
R9235:Efcab3 UTSW 11 104,907,987 (GRCm39) missense probably benign 0.19
R9294:Efcab3 UTSW 11 104,722,126 (GRCm39) missense probably benign 0.24
R9318:Efcab3 UTSW 11 104,856,648 (GRCm39) critical splice donor site probably null
R9322:Efcab3 UTSW 11 104,765,199 (GRCm39) missense probably benign 0.36
R9361:Efcab3 UTSW 11 104,896,524 (GRCm39) missense probably benign 0.03
R9408:Efcab3 UTSW 11 104,621,255 (GRCm39) critical splice donor site probably null
R9434:Efcab3 UTSW 11 104,899,863 (GRCm39) missense probably benign 0.24
R9477:Efcab3 UTSW 11 104,836,698 (GRCm39) missense unknown
R9658:Efcab3 UTSW 11 104,611,120 (GRCm39) missense probably benign 0.03
R9719:Efcab3 UTSW 11 104,867,912 (GRCm39) missense unknown
R9751:Efcab3 UTSW 11 104,783,911 (GRCm39) missense probably benign 0.19
R9763:Efcab3 UTSW 11 104,890,485 (GRCm39) missense possibly damaging 0.89
X0026:Efcab3 UTSW 11 105,007,937 (GRCm39) missense probably benign 0.03
X0026:Efcab3 UTSW 11 104,611,801 (GRCm39) missense probably benign 0.07
Z1088:Efcab3 UTSW 11 104,642,728 (GRCm39) missense probably damaging 0.96
Z1176:Efcab3 UTSW 11 104,990,872 (GRCm39) missense probably damaging 1.00
Z1176:Efcab3 UTSW 11 104,892,793 (GRCm39) missense probably benign 0.29
Z1176:Efcab3 UTSW 11 104,999,598 (GRCm39) nonsense probably null
Z1177:Efcab3 UTSW 11 104,814,845 (GRCm39) missense unknown
Z1177:Efcab3 UTSW 11 104,711,344 (GRCm39) missense probably benign 0.03
Z1177:Efcab3 UTSW 11 104,630,164 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCTGTAACAAGGCTGAGTGC -3'
(R):5'- CCGTGTTCCTAACAGAATGACC -3'

Sequencing Primer
(F):5'- CATGGACCATGCCTTAGGTTTGTATC -3'
(R):5'- GTGTTCCTAACAGAATGACCACAAC -3'
Posted On 2021-07-15