Mutagenetix > Incidental Mutation

Incidental Mutation 'R8879:Slc10a1'

676789

Institutional Source

Beutler Lab

Gene Symbol

Slc10a1

Ensembl Gene

ENSMUSG00000021135

Gene Name

solute carrier family 10 (sodium/bile acid cotransporter family), member 1

Synonyms

Ntcp, sodium bile acid cotransporting polypeptide

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8879 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80953183-80968705 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 80967595 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 117 (N117I)

Ref Sequence

ENSEMBL: ENSMUSP00000093229 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095572] [ENSMUST00000218162] [ENSMUST00000218342] [ENSMUST00000220266]

AlphaFold

O08705

Predicted Effect

probably damaging
Transcript: ENSMUST00000095572
AA Change: N117I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000093229
Gene: ENSMUSG00000021135
AA Change: N117I

Domain	Start	End	E-Value	Type
Pfam:SBF	32	217	3.3e-47	PFAM
transmembrane domain	222	244	N/A	INTRINSIC
transmembrane domain	282	304	N/A	INTRINSIC
low complexity region	323	333	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000218162
AA Change: N117I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000218342
AA Change: N117I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Predicted Effect

probably benign
Transcript: ENSMUST00000220266

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the sodium/bile acid cotransporter family, which are integral membrane glycoproteins that participate in the enterohepatic circulation of bile acids. Two homologous transporters are involved in the reabsorption of bile acids; the ileal sodium/bile acid cotransporter with an apical cell localization that absorbs bile acids from the intestinal lumen, bile duct and kidney, and the liver-specific sodium/bile acid cotransporter, represented by this protein, that is found in the basolateral membranes of hepatocytes. Bile acids are the catabolic product of cholesterol metabolism, hence this protein is important for cholesterol homeostasis. [provided by RefSeq, Oct 2011]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130401M01Rik	C	T	15: 58,022,509	V326M	probably damaging	Het
Adap2	T	A	11: 80,156,959	H80Q	probably benign	Het
Ang4	T	C	14: 51,764,486	T2A	probably benign	Het
Arf2	T	C	11: 103,979,759		probably null	Het
B3gnt4	A	G	5: 123,511,148	D192G	probably damaging	Het
BC034090	T	C	1: 155,226,357	I54V	probably benign	Het
Catsper3	A	G	13: 55,804,895	T202A	probably benign	Het
Cenpe	T	A	3: 135,260,101	D2113E	probably damaging	Het
Clasp2	T	C	9: 113,773,705	V191A	probably benign	Het
Col5a1	G	T	2: 28,014,158	A1356S	unknown	Het
Cuzd1	A	G	7: 131,308,848	S573P	probably damaging	Het
Cyp1a2	C	A	9: 57,681,885	M215I	possibly damaging	Het
Dcaf17	T	A	2: 71,063,402	I122K	possibly damaging	Het
Dhcr24	A	G	4: 106,573,809	I232V	probably benign	Het
Dnah10	A	G	5: 124,818,117	E3570G	probably damaging	Het
Dnaja4	A	T	9: 54,714,704		probably benign	Het
Ehd1	A	G	19: 6,298,324	D444G	probably damaging	Het
Ehmt1	T	A	2: 24,836,476	M766L	possibly damaging	Het
Eno4	A	G	19: 58,970,722	I613M	probably benign	Het
Exoc3l	A	T	8: 105,290,549	M602K		Het
Fam107a	C	T	14: 8,301,352		probably null	Het
Frem3	A	T	8: 80,613,148	D690V	probably damaging	Het
Gm11639	T	C	11: 104,690,955	I41T	probably benign	Het
Gm19410	A	T	8: 35,771,868	D97V	probably damaging	Het
Grik5	T	A	7: 25,023,064	D540V	possibly damaging	Het
Hint1	T	A	11: 54,869,943	D69E	probably benign	Het
Krt13	T	C	11: 100,119,385	T257A	probably benign	Het
Lpin2	T	C	17: 71,242,754	L676P	probably damaging	Het
Lrguk	A	G	6: 34,029,683	E76G	probably benign	Het
Lrrc8a	A	G	2: 30,256,298	M375V	probably benign	Het
Lrrtm3	T	C	10: 64,089,238	Q50R	possibly damaging	Het
Mmrn1	T	A	6: 60,976,529	L598Q	probably damaging	Het
Mrs2	A	G	13: 25,001,784	I135T	probably damaging	Het
Neb	T	C	2: 52,235,580	D475G		Het
Notch2	A	G	3: 98,135,599	S1427G	possibly damaging	Het
Olfr118	C	A	17: 37,672,411	Y129*	probably null	Het
Olfr682-ps1	A	G	7: 105,126,686	V195A	probably benign	Het
Olfr694	A	T	7: 106,689,089	I214N	probably damaging	Het
Olfr816	A	G	10: 129,911,862	C139R	probably damaging	Het
Olfr952	A	C	9: 39,426,219	V284G	possibly damaging	Het
Opcml	T	C	9: 28,902,151	F246S	probably damaging	Het
Pdzd2	C	A	15: 12,402,319	V729F	probably damaging	Het
Pias2	C	T	18: 77,146,768	Q565*	probably null	Het
Pnp	T	A	14: 50,950,720		probably null	Het
Ptpn18	T	C	1: 34,463,130	S76P	probably benign	Het
Qtrt2	A	T	16: 43,863,197	L304Q	probably damaging	Het
Rad51ap2	A	T	12: 11,457,400	E441V	possibly damaging	Het
Ranbp2	T	A	10: 58,477,889	V1477E	probably benign	Het
Repin1	C	T	6: 48,597,433	T432I	possibly damaging	Het
Rest	G	A	5: 77,282,511	G926R	probably benign	Het
Rnft1	T	A	11: 86,486,690	F143L	possibly damaging	Het
Sema3e	A	T	5: 14,232,094	I415L	probably benign	Het
Slc25a23	G	A	17: 57,059,709		probably benign	Het
Slc2a2	T	C	3: 28,713,802	S160P	possibly damaging	Het
Srrd	A	G	5: 112,338,456	V178A	possibly damaging	Het
Tmigd3	G	T	3: 105,921,961	G198C	probably benign	Het
Trbv29	G	A	6: 41,271,405	M1I	probably null	Het
Tril	A	G	6: 53,819,584	S218P	probably damaging	Het
Trip11	T	C	12: 101,862,598	K1749R	probably benign	Het
Ttc25	G	T	11: 100,566,926	E452*	probably null	Het
Ttn	A	G	2: 76,830,651	V12011A		Het
Ubr4	T	G	4: 139,410,518	F1093V	probably benign	Het
Urb2	C	A	8: 124,028,403	A283E	probably benign	Het
Usp43	T	A	11: 67,898,881		probably benign	Het
Vmn1r28	A	T	6: 58,265,684	I171F	probably benign	Het
Vps33a	G	A	5: 123,533,899	R469W	probably damaging	Het
Zfp202	G	A	9: 40,211,757	R605Q	probably damaging	Het
Zpbp2	A	T	11: 98,554,620	H158L	probably benign	Het

Other mutations in Slc10a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01870:Slc10a1	APN	12	80960528	missense	probably benign	0.00
IGL02065:Slc10a1	APN	12	80960474	missense	possibly damaging	0.94
R0212:Slc10a1	UTSW	12	80967712	missense	possibly damaging	0.62
R1170:Slc10a1	UTSW	12	80956028	missense	probably damaging	1.00
R1261:Slc10a1	UTSW	12	80967830	missense	probably damaging	1.00
R1832:Slc10a1	UTSW	12	80953672	missense	probably benign	0.23
R2010:Slc10a1	UTSW	12	80960447	missense	probably benign	0.00
R2094:Slc10a1	UTSW	12	80956048	missense	possibly damaging	0.88
R2206:Slc10a1	UTSW	12	80967628	missense	probably damaging	0.99
R3905:Slc10a1	UTSW	12	80967667	missense	probably damaging	0.99
R4392:Slc10a1	UTSW	12	80967804	missense	probably damaging	1.00
R4413:Slc10a1	UTSW	12	80958132	missense	probably benign	0.01
R5173:Slc10a1	UTSW	12	80956028	missense	probably damaging	1.00
R5344:Slc10a1	UTSW	12	80953766	missense	possibly damaging	0.56
R7173:Slc10a1	UTSW	12	80955976	missense	probably damaging	1.00
R7253:Slc10a1	UTSW	12	80958184	missense	probably benign	0.16
R7413:Slc10a1	UTSW	12	80960622	missense	probably benign	0.00
R7990:Slc10a1	UTSW	12	80953780	missense	probably benign	0.01
R9304:Slc10a1	UTSW	12	80958183	missense	probably benign	0.00
R9483:Slc10a1	UTSW	12	80956090	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCCTGGGATTTAAACCAAAGAG -3'
(R):5'- CAAGATCAAGGCTCACTTCTGG -3'

Sequencing Primer
(F):5'- AAGAGATTCCAGAGGCTGCCC -3'
(R):5'- TCAAGGCTCACTTCTGGAAGCC -3'

Posted On

2021-07-15