Incidental Mutation 'R8879:Trip11'
ID 676790
Institutional Source Beutler Lab
Gene Symbol Trip11
Ensembl Gene ENSMUSG00000021188
Gene Name thyroid hormone receptor interactor 11
Synonyms GMAP-210, 3110031G15Rik, 2610511G22Rik, 6030460N08Rik, TRIP230
MMRRC Submission
Accession Numbers

Genbank: NM_028446.1; Ensembl: ENSMUST00000021605, ENSMUST00000085086, ENSMUST00000110038
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8879 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 101834043-101913267 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 101862598 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 1749 (K1749R)
Ref Sequence ENSEMBL: ENSMUSP00000021605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021605] [ENSMUST00000177183]
AlphaFold E9Q512
Predicted Effect probably benign
Transcript: ENSMUST00000021605
AA Change: K1749R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000021605
Gene: ENSMUSG00000021188
AA Change: K1749R

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
coiled coil region 54 130 N/A INTRINSIC
coiled coil region 167 194 N/A INTRINSIC
coiled coil region 218 702 N/A INTRINSIC
coiled coil region 754 990 N/A INTRINSIC
coiled coil region 1022 1051 N/A INTRINSIC
coiled coil region 1196 1261 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
coiled coil region 1336 1481 N/A INTRINSIC
coiled coil region 1547 1657 N/A INTRINSIC
coiled coil region 1681 1771 N/A INTRINSIC
low complexity region 1934 1945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177183
AA Change: K1464R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000134976
Gene: ENSMUSG00000021188
AA Change: K1464R

DomainStartEndE-ValueType
coiled coil region 33 158 N/A INTRINSIC
coiled coil region 179 417 N/A INTRINSIC
coiled coil region 469 705 N/A INTRINSIC
coiled coil region 737 766 N/A INTRINSIC
coiled coil region 911 976 N/A INTRINSIC
low complexity region 1025 1037 N/A INTRINSIC
coiled coil region 1051 1196 N/A INTRINSIC
coiled coil region 1262 1372 N/A INTRINSIC
coiled coil region 1396 1486 N/A INTRINSIC
low complexity region 1649 1660 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on the interaction of its protein product with thyroid hormone receptor beta. This protein is associated with the Golgi apparatus. The N-terminal region of the protein binds Golgi membranes and the C-terminal region binds the minus ends of microtubules; thus, the protein is thought to play a role in assembly and maintenance of the Golgi ribbon structure around the centrosome. Mutations in this gene cause achondrogenesis type IA.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with small size, lung hypoplasia, omphalocele, and ventricular septal defects. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Gene trapped(11) Chemically induced(1)
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C T 15: 58,022,509 V326M probably damaging Het
Adap2 T A 11: 80,156,959 H80Q probably benign Het
Ang4 T C 14: 51,764,486 T2A probably benign Het
Arf2 T C 11: 103,979,759 probably null Het
B3gnt4 A G 5: 123,511,148 D192G probably damaging Het
BC034090 T C 1: 155,226,357 I54V probably benign Het
Catsper3 A G 13: 55,804,895 T202A probably benign Het
Cenpe T A 3: 135,260,101 D2113E probably damaging Het
Clasp2 T C 9: 113,773,705 V191A probably benign Het
Col5a1 G T 2: 28,014,158 A1356S unknown Het
Cuzd1 A G 7: 131,308,848 S573P probably damaging Het
Cyp1a2 C A 9: 57,681,885 M215I possibly damaging Het
Dcaf17 T A 2: 71,063,402 I122K possibly damaging Het
Dhcr24 A G 4: 106,573,809 I232V probably benign Het
Dnah10 A G 5: 124,818,117 E3570G probably damaging Het
Dnaja4 A T 9: 54,714,704 probably benign Het
Ehd1 A G 19: 6,298,324 D444G probably damaging Het
Ehmt1 T A 2: 24,836,476 M766L possibly damaging Het
Eno4 A G 19: 58,970,722 I613M probably benign Het
Exoc3l A T 8: 105,290,549 M602K Het
Fam107a C T 14: 8,301,352 probably null Het
Frem3 A T 8: 80,613,148 D690V probably damaging Het
Gm11639 T C 11: 104,690,955 I41T probably benign Het
Gm19410 A T 8: 35,771,868 D97V probably damaging Het
Grik5 T A 7: 25,023,064 D540V possibly damaging Het
Hint1 T A 11: 54,869,943 D69E probably benign Het
Krt13 T C 11: 100,119,385 T257A probably benign Het
Lpin2 T C 17: 71,242,754 L676P probably damaging Het
Lrguk A G 6: 34,029,683 E76G probably benign Het
Lrrc8a A G 2: 30,256,298 M375V probably benign Het
Lrrtm3 T C 10: 64,089,238 Q50R possibly damaging Het
Mmrn1 T A 6: 60,976,529 L598Q probably damaging Het
Mrs2 A G 13: 25,001,784 I135T probably damaging Het
Neb T C 2: 52,235,580 D475G Het
Notch2 A G 3: 98,135,599 S1427G possibly damaging Het
Olfr118 C A 17: 37,672,411 Y129* probably null Het
Olfr682-ps1 A G 7: 105,126,686 V195A probably benign Het
Olfr694 A T 7: 106,689,089 I214N probably damaging Het
Olfr816 A G 10: 129,911,862 C139R probably damaging Het
Olfr952 A C 9: 39,426,219 V284G possibly damaging Het
Opcml T C 9: 28,902,151 F246S probably damaging Het
Pdzd2 C A 15: 12,402,319 V729F probably damaging Het
Pias2 C T 18: 77,146,768 Q565* probably null Het
Pnp T A 14: 50,950,720 probably null Het
Ptpn18 T C 1: 34,463,130 S76P probably benign Het
Qtrt2 A T 16: 43,863,197 L304Q probably damaging Het
Rad51ap2 A T 12: 11,457,400 E441V possibly damaging Het
Ranbp2 T A 10: 58,477,889 V1477E probably benign Het
Repin1 C T 6: 48,597,433 T432I possibly damaging Het
Rest G A 5: 77,282,511 G926R probably benign Het
Rnft1 T A 11: 86,486,690 F143L possibly damaging Het
Sema3e A T 5: 14,232,094 I415L probably benign Het
Slc10a1 T A 12: 80,967,595 N117I probably damaging Het
Slc25a23 G A 17: 57,059,709 probably benign Het
Slc2a2 T C 3: 28,713,802 S160P possibly damaging Het
Srrd A G 5: 112,338,456 V178A possibly damaging Het
Tmigd3 G T 3: 105,921,961 G198C probably benign Het
Trbv29 G A 6: 41,271,405 M1I probably null Het
Tril A G 6: 53,819,584 S218P probably damaging Het
Ttc25 G T 11: 100,566,926 E452* probably null Het
Ttn A G 2: 76,830,651 V12011A Het
Ubr4 T G 4: 139,410,518 F1093V probably benign Het
Urb2 C A 8: 124,028,403 A283E probably benign Het
Usp43 T A 11: 67,898,881 probably benign Het
Vmn1r28 A T 6: 58,265,684 I171F probably benign Het
Vps33a G A 5: 123,533,899 R469W probably damaging Het
Zfp202 G A 9: 40,211,757 R605Q probably damaging Het
Zpbp2 A T 11: 98,554,620 H158L probably benign Het
Other mutations in Trip11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Trip11 APN 12 101886147 missense probably benign 0.37
IGL00484:Trip11 APN 12 101885311 nonsense probably null
IGL00972:Trip11 APN 12 101894337 missense probably null 1.00
IGL01476:Trip11 APN 12 101898911 missense probably damaging 0.96
IGL01591:Trip11 APN 12 101883345 missense probably damaging 0.98
IGL01667:Trip11 APN 12 101878862 missense probably damaging 1.00
IGL01764:Trip11 APN 12 101884631 missense probably damaging 1.00
IGL01789:Trip11 APN 12 101871831 missense probably benign 0.05
IGL01814:Trip11 APN 12 101884488 missense probably damaging 0.98
IGL01898:Trip11 APN 12 101885676 missense probably benign
IGL01924:Trip11 APN 12 101886884 missense possibly damaging 0.93
IGL02020:Trip11 APN 12 101884313 missense probably damaging 1.00
IGL02475:Trip11 APN 12 101895683 missense probably benign 0.01
IGL02544:Trip11 APN 12 101893521 missense probably damaging 1.00
IGL02678:Trip11 APN 12 101883390 missense probably damaging 0.96
IGL02714:Trip11 APN 12 101884001 missense probably damaging 1.00
IGL02718:Trip11 APN 12 101886025 missense probably benign 0.24
IGL02904:Trip11 APN 12 101886838 missense probably damaging 1.00
IGL03012:Trip11 APN 12 101883936 missense probably damaging 1.00
IGL03191:Trip11 APN 12 101898925 missense probably damaging 1.00
IGL03327:Trip11 APN 12 101883418 missense possibly damaging 0.87
IGL03337:Trip11 APN 12 101885019 missense probably damaging 1.00
NA:Trip11 UTSW 12 101894321 splice site probably null
R0027:Trip11 UTSW 12 101885169 missense probably benign 0.00
R0028:Trip11 UTSW 12 101884757 missense probably damaging 1.00
R0238:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0238:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0239:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0239:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0505:Trip11 UTSW 12 101885672 missense probably damaging 0.98
R0556:Trip11 UTSW 12 101884518 nonsense probably null
R0573:Trip11 UTSW 12 101886860 missense probably benign 0.02
R0626:Trip11 UTSW 12 101885976 missense possibly damaging 0.54
R1519:Trip11 UTSW 12 101886160 missense probably benign 0.04
R1530:Trip11 UTSW 12 101912767 missense unknown
R1647:Trip11 UTSW 12 101884392 nonsense probably null
R1648:Trip11 UTSW 12 101884392 nonsense probably null
R1856:Trip11 UTSW 12 101883333 nonsense probably null
R2013:Trip11 UTSW 12 101837722 missense probably damaging 1.00
R2017:Trip11 UTSW 12 101885360 missense probably benign 0.00
R2206:Trip11 UTSW 12 101873442 missense probably benign 0.25
R2207:Trip11 UTSW 12 101873442 missense probably benign 0.25
R2304:Trip11 UTSW 12 101898977 missense possibly damaging 0.58
R2328:Trip11 UTSW 12 101878827 makesense probably null
R2513:Trip11 UTSW 12 101837727 missense possibly damaging 0.94
R3499:Trip11 UTSW 12 101893694 missense possibly damaging 0.87
R4105:Trip11 UTSW 12 101894322 nonsense probably null
R4124:Trip11 UTSW 12 101895698 nonsense probably null
R4126:Trip11 UTSW 12 101895698 nonsense probably null
R4128:Trip11 UTSW 12 101895698 nonsense probably null
R4175:Trip11 UTSW 12 101895698 nonsense probably null
R4176:Trip11 UTSW 12 101895698 nonsense probably null
R4181:Trip11 UTSW 12 101893768 missense probably damaging 1.00
R4296:Trip11 UTSW 12 101885868 nonsense probably null
R4302:Trip11 UTSW 12 101893768 missense probably damaging 1.00
R4306:Trip11 UTSW 12 101886939 missense probably benign
R4342:Trip11 UTSW 12 101884316 missense probably damaging 1.00
R4576:Trip11 UTSW 12 101886240 nonsense probably null
R4586:Trip11 UTSW 12 101883341 missense possibly damaging 0.55
R4634:Trip11 UTSW 12 101837616 missense probably damaging 1.00
R4696:Trip11 UTSW 12 101885290 missense possibly damaging 0.71
R4792:Trip11 UTSW 12 101885446 missense probably benign 0.10
R4903:Trip11 UTSW 12 101886806 critical splice donor site probably null
R5001:Trip11 UTSW 12 101884910 nonsense probably null
R5017:Trip11 UTSW 12 101846620 missense probably benign 0.00
R5227:Trip11 UTSW 12 101884920 missense probably damaging 1.00
R5231:Trip11 UTSW 12 101885601 missense probably damaging 0.96
R5539:Trip11 UTSW 12 101885127 missense probably damaging 0.98
R5754:Trip11 UTSW 12 101885665 nonsense probably null
R5755:Trip11 UTSW 12 101885665 nonsense probably null
R5890:Trip11 UTSW 12 101885972 missense probably damaging 0.99
R5910:Trip11 UTSW 12 101883479 missense probably damaging 1.00
R6083:Trip11 UTSW 12 101889742 missense probably benign 0.00
R6208:Trip11 UTSW 12 101898895 missense probably damaging 1.00
R6216:Trip11 UTSW 12 101890600 missense probably benign 0.31
R6315:Trip11 UTSW 12 101885578 missense possibly damaging 0.84
R6413:Trip11 UTSW 12 101885531 missense probably benign 0.12
R6590:Trip11 UTSW 12 101885451 missense possibly damaging 0.92
R6690:Trip11 UTSW 12 101885451 missense possibly damaging 0.92
R6914:Trip11 UTSW 12 101846620 missense probably benign 0.00
R6938:Trip11 UTSW 12 101837627 missense probably damaging 0.98
R7015:Trip11 UTSW 12 101893683 missense probably damaging 1.00
R7023:Trip11 UTSW 12 101885867 missense probably benign 0.13
R7133:Trip11 UTSW 12 101884070 missense probably damaging 0.97
R7271:Trip11 UTSW 12 101884352 missense probably damaging 1.00
R7424:Trip11 UTSW 12 101885198 missense probably damaging 1.00
R7431:Trip11 UTSW 12 101884019 missense possibly damaging 0.84
R7472:Trip11 UTSW 12 101885380 missense probably benign 0.00
R7491:Trip11 UTSW 12 101885435 missense probably damaging 1.00
R7752:Trip11 UTSW 12 101886974 missense probably benign 0.01
R7763:Trip11 UTSW 12 101844855 missense probably benign 0.03
R7779:Trip11 UTSW 12 101883537 missense probably damaging 0.97
R7844:Trip11 UTSW 12 101878144 missense probably damaging 1.00
R8055:Trip11 UTSW 12 101837665 missense probably damaging 1.00
R8076:Trip11 UTSW 12 101883482 missense probably damaging 1.00
R8288:Trip11 UTSW 12 101894384 missense possibly damaging 0.73
R8294:Trip11 UTSW 12 101844901 missense possibly damaging 0.93
R8318:Trip11 UTSW 12 101912804 missense unknown
R8690:Trip11 UTSW 12 101873397 missense possibly damaging 0.76
R8964:Trip11 UTSW 12 101845056 critical splice donor site probably null
R9005:Trip11 UTSW 12 101878872 missense probably benign 0.02
R9013:Trip11 UTSW 12 101885118 missense probably damaging 0.99
R9020:Trip11 UTSW 12 101884511 missense possibly damaging 0.91
R9041:Trip11 UTSW 12 101878868 missense probably benign 0.06
R9234:Trip11 UTSW 12 101845731 critical splice donor site probably null
R9447:Trip11 UTSW 12 101883889 missense probably damaging 1.00
R9631:Trip11 UTSW 12 101893548 missense probably benign
R9641:Trip11 UTSW 12 101893698 nonsense probably null
R9691:Trip11 UTSW 12 101883864 missense probably benign 0.00
R9751:Trip11 UTSW 12 101884506 missense possibly damaging 0.54
X0020:Trip11 UTSW 12 101885913 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCAATAGGTGACAGGCAACAC -3'
(R):5'- ATTGATTCTGAAGCACCTCCC -3'

Sequencing Primer
(F):5'- TCACTATCCAGGAGAGCTGACTG -3'
(R):5'- ACCTCCCAGCCCAGTAGTTG -3'
Posted On 2021-07-15