Incidental Mutation 'R8879:Slc25a23'
ID 676800
Institutional Source Beutler Lab
Gene Symbol Slc25a23
Ensembl Gene ENSMUSG00000046329
Gene Name solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8879 (G1)
Quality Score 106.008
Status Validated
Chromosome 17
Chromosomal Location 57043711-57059863 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) G to A at 57059709 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000040280] [ENSMUST00000071826] [ENSMUST00000097299] [ENSMUST00000163628] [ENSMUST00000163763] [ENSMUST00000169543]
AlphaFold Q6GQS1
Predicted Effect probably benign
Transcript: ENSMUST00000040280
SMART Domains Protein: ENSMUSP00000040198
Gene: ENSMUSG00000046329

DomainStartEndE-ValueType
EFh 13 41 2.72e-3 SMART
EFh 80 108 1.09e0 SMART
EFh 116 144 3.07e1 SMART
Pfam:Mito_carr 181 273 3.8e-25 PFAM
Pfam:Mito_carr 274 366 4.1e-26 PFAM
Pfam:Mito_carr 372 465 6.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071826
SMART Domains Protein: ENSMUSP00000071729
Gene: ENSMUSG00000044279

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097299
SMART Domains Protein: ENSMUSP00000094902
Gene: ENSMUSG00000044279

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163628
SMART Domains Protein: ENSMUSP00000126402
Gene: ENSMUSG00000044279

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SCOP:d1fwxa1 30 52 5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163763
SMART Domains Protein: ENSMUSP00000132502
Gene: ENSMUSG00000044279

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169543
SMART Domains Protein: ENSMUSP00000125760
Gene: ENSMUSG00000044279

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171128
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (69/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired mitochondrial function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C T 15: 58,022,509 V326M probably damaging Het
Adap2 T A 11: 80,156,959 H80Q probably benign Het
Ang4 T C 14: 51,764,486 T2A probably benign Het
Arf2 T C 11: 103,979,759 probably null Het
B3gnt4 A G 5: 123,511,148 D192G probably damaging Het
BC034090 T C 1: 155,226,357 I54V probably benign Het
Catsper3 A G 13: 55,804,895 T202A probably benign Het
Cenpe T A 3: 135,260,101 D2113E probably damaging Het
Clasp2 T C 9: 113,773,705 V191A probably benign Het
Col5a1 G T 2: 28,014,158 A1356S unknown Het
Cuzd1 A G 7: 131,308,848 S573P probably damaging Het
Cyp1a2 C A 9: 57,681,885 M215I possibly damaging Het
Dcaf17 T A 2: 71,063,402 I122K possibly damaging Het
Dhcr24 A G 4: 106,573,809 I232V probably benign Het
Dnah10 A G 5: 124,818,117 E3570G probably damaging Het
Dnaja4 A T 9: 54,714,704 probably benign Het
Ehd1 A G 19: 6,298,324 D444G probably damaging Het
Ehmt1 T A 2: 24,836,476 M766L possibly damaging Het
Eno4 A G 19: 58,970,722 I613M probably benign Het
Exoc3l A T 8: 105,290,549 M602K Het
Fam107a C T 14: 8,301,352 probably null Het
Frem3 A T 8: 80,613,148 D690V probably damaging Het
Gm11639 T C 11: 104,690,955 I41T probably benign Het
Gm19410 A T 8: 35,771,868 D97V probably damaging Het
Grik5 T A 7: 25,023,064 D540V possibly damaging Het
Hint1 T A 11: 54,869,943 D69E probably benign Het
Krt13 T C 11: 100,119,385 T257A probably benign Het
Lpin2 T C 17: 71,242,754 L676P probably damaging Het
Lrguk A G 6: 34,029,683 E76G probably benign Het
Lrrc8a A G 2: 30,256,298 M375V probably benign Het
Lrrtm3 T C 10: 64,089,238 Q50R possibly damaging Het
Mmrn1 T A 6: 60,976,529 L598Q probably damaging Het
Mrs2 A G 13: 25,001,784 I135T probably damaging Het
Neb T C 2: 52,235,580 D475G Het
Notch2 A G 3: 98,135,599 S1427G possibly damaging Het
Olfr118 C A 17: 37,672,411 Y129* probably null Het
Olfr682-ps1 A G 7: 105,126,686 V195A probably benign Het
Olfr694 A T 7: 106,689,089 I214N probably damaging Het
Olfr816 A G 10: 129,911,862 C139R probably damaging Het
Olfr952 A C 9: 39,426,219 V284G possibly damaging Het
Opcml T C 9: 28,902,151 F246S probably damaging Het
Pdzd2 C A 15: 12,402,319 V729F probably damaging Het
Pias2 C T 18: 77,146,768 Q565* probably null Het
Pnp T A 14: 50,950,720 probably null Het
Ptpn18 T C 1: 34,463,130 S76P probably benign Het
Qtrt2 A T 16: 43,863,197 L304Q probably damaging Het
Rad51ap2 A T 12: 11,457,400 E441V possibly damaging Het
Ranbp2 T A 10: 58,477,889 V1477E probably benign Het
Repin1 C T 6: 48,597,433 T432I possibly damaging Het
Rest G A 5: 77,282,511 G926R probably benign Het
Rnft1 T A 11: 86,486,690 F143L possibly damaging Het
Sema3e A T 5: 14,232,094 I415L probably benign Het
Slc10a1 T A 12: 80,967,595 N117I probably damaging Het
Slc2a2 T C 3: 28,713,802 S160P possibly damaging Het
Srrd A G 5: 112,338,456 V178A possibly damaging Het
Tmigd3 G T 3: 105,921,961 G198C probably benign Het
Trbv29 G A 6: 41,271,405 M1I probably null Het
Tril A G 6: 53,819,584 S218P probably damaging Het
Trip11 T C 12: 101,862,598 K1749R probably benign Het
Ttc25 G T 11: 100,566,926 E452* probably null Het
Ttn A G 2: 76,830,651 V12011A Het
Ubr4 T G 4: 139,410,518 F1093V probably benign Het
Urb2 C A 8: 124,028,403 A283E probably benign Het
Usp43 T A 11: 67,898,881 probably benign Het
Vmn1r28 A T 6: 58,265,684 I171F probably benign Het
Vps33a G A 5: 123,533,899 R469W probably damaging Het
Zfp202 G A 9: 40,211,757 R605Q probably damaging Het
Zpbp2 A T 11: 98,554,620 H158L probably benign Het
Other mutations in Slc25a23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Slc25a23 APN 17 57047233 missense probably benign 0.01
IGL01614:Slc25a23 APN 17 57045579 missense probably null 0.98
IGL01919:Slc25a23 APN 17 57047291 missense possibly damaging 0.61
IGL01933:Slc25a23 APN 17 57052813 nonsense probably null
IGL02297:Slc25a23 APN 17 57053324 missense probably benign 0.00
R1317:Slc25a23 UTSW 17 57053888 missense possibly damaging 0.63
R1411:Slc25a23 UTSW 17 57059622 missense probably damaging 0.97
R1577:Slc25a23 UTSW 17 57047306 missense probably benign 0.00
R2156:Slc25a23 UTSW 17 57045562 missense probably benign 0.00
R4581:Slc25a23 UTSW 17 57052740 missense probably damaging 0.96
R4755:Slc25a23 UTSW 17 57052794 missense possibly damaging 0.92
R4786:Slc25a23 UTSW 17 57047326 missense possibly damaging 0.68
R4789:Slc25a23 UTSW 17 57059597 missense probably damaging 1.00
R5402:Slc25a23 UTSW 17 57053336 missense probably benign 0.07
R5423:Slc25a23 UTSW 17 57053597 missense probably damaging 0.99
R5478:Slc25a23 UTSW 17 57052780 missense probably damaging 1.00
R5659:Slc25a23 UTSW 17 57045500 unclassified probably benign
R5787:Slc25a23 UTSW 17 57053825 missense probably damaging 1.00
R6417:Slc25a23 UTSW 17 57052780 missense probably damaging 0.98
R6420:Slc25a23 UTSW 17 57052780 missense probably damaging 0.98
R6462:Slc25a23 UTSW 17 57052720 missense probably damaging 1.00
R6830:Slc25a23 UTSW 17 57053804 nonsense probably null
R6858:Slc25a23 UTSW 17 57058171 missense probably damaging 1.00
R7311:Slc25a23 UTSW 17 57052827 missense probably damaging 1.00
R7381:Slc25a23 UTSW 17 57053587 missense probably damaging 1.00
R7491:Slc25a23 UTSW 17 57052822 nonsense probably null
R7543:Slc25a23 UTSW 17 57058106 critical splice donor site probably null
R7646:Slc25a23 UTSW 17 57059759 unclassified probably benign
R9042:Slc25a23 UTSW 17 57045553 missense probably damaging 1.00
R9076:Slc25a23 UTSW 17 57047309 missense probably benign 0.00
R9399:Slc25a23 UTSW 17 57053930 missense probably damaging 1.00
X0026:Slc25a23 UTSW 17 57055350 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ATAGTACCTGCTGTGCACG -3'
(R):5'- GATGTGCAAAACCAGAGCC -3'

Sequencing Primer
(F):5'- TGTGCACGGTCCGGATCTC -3'
(R):5'- AGAGCCTCCTAGAATGCTTCC -3'
Posted On 2021-07-15