Mutagenetix > Incidental Mutation

Incidental Mutation 'R8879:Lpin2'

676801

Institutional Source

Beutler Lab

Gene Symbol

Lpin2

Ensembl Gene

ENSMUSG00000024052

Gene Name

lipin 2

Synonyms

2610511G02Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.555) question?

Stock #

R8879 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

71182560-71249817 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 71242754 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 676 (L676P)

Ref Sequence

ENSEMBL: ENSMUSP00000118610 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000126681] [ENSMUST00000129635]

AlphaFold

Q99PI5

Predicted Effect

probably damaging
Transcript: ENSMUST00000126681
AA Change: L676P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118610
Gene: ENSMUSG00000024052
AA Change: L676P

Domain	Start	End	E-Value	Type
Pfam:Lipin_N	39	148	1e-47	PFAM
low complexity region	191	206	N/A	INTRINSIC
low complexity region	217	227	N/A	INTRINSIC
low complexity region	398	420	N/A	INTRINSIC
Pfam:Lipin_mid	504	596	6.1e-37	PFAM
LNS2	720	876	2.18e-107	SMART
low complexity region	924	930	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000129635
AA Change: L638P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119282
Gene: ENSMUSG00000024052
AA Change: L638P

Domain	Start	End	E-Value	Type
Pfam:Lipin_N	1	114	2.2e-53	PFAM
low complexity region	153	168	N/A	INTRINSIC
low complexity region	179	189	N/A	INTRINSIC
low complexity region	360	382	N/A	INTRINSIC
LNS2	682	838	2.18e-107	SMART
low complexity region	886	892	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000154507

SMART Domains

Protein: ENSMUSP00000127035
Gene: ENSMUSG00000024052

Domain	Start	End	E-Value	Type
Pfam:Lipin_mid	1	55	2.3e-20	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mouse studies suggest that this gene functions during normal adipose tissue development and may play a role in human triglyceride metabolism. This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop ataxia, impaired blance, and tremors with age and show altered cerebellar phospholipid composition and anemia. Mice show diet-induced hepatic triglyceride accumulation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130401M01Rik	C	T	15: 58,022,509	V326M	probably damaging	Het
Adap2	T	A	11: 80,156,959	H80Q	probably benign	Het
Ang4	T	C	14: 51,764,486	T2A	probably benign	Het
Arf2	T	C	11: 103,979,759		probably null	Het
B3gnt4	A	G	5: 123,511,148	D192G	probably damaging	Het
BC034090	T	C	1: 155,226,357	I54V	probably benign	Het
Catsper3	A	G	13: 55,804,895	T202A	probably benign	Het
Cenpe	T	A	3: 135,260,101	D2113E	probably damaging	Het
Clasp2	T	C	9: 113,773,705	V191A	probably benign	Het
Col5a1	G	T	2: 28,014,158	A1356S	unknown	Het
Cuzd1	A	G	7: 131,308,848	S573P	probably damaging	Het
Cyp1a2	C	A	9: 57,681,885	M215I	possibly damaging	Het
Dcaf17	T	A	2: 71,063,402	I122K	possibly damaging	Het
Dhcr24	A	G	4: 106,573,809	I232V	probably benign	Het
Dnah10	A	G	5: 124,818,117	E3570G	probably damaging	Het
Dnaja4	A	T	9: 54,714,704		probably benign	Het
Ehd1	A	G	19: 6,298,324	D444G	probably damaging	Het
Ehmt1	T	A	2: 24,836,476	M766L	possibly damaging	Het
Eno4	A	G	19: 58,970,722	I613M	probably benign	Het
Exoc3l	A	T	8: 105,290,549	M602K		Het
Fam107a	C	T	14: 8,301,352		probably null	Het
Frem3	A	T	8: 80,613,148	D690V	probably damaging	Het
Gm11639	T	C	11: 104,690,955	I41T	probably benign	Het
Gm19410	A	T	8: 35,771,868	D97V	probably damaging	Het
Grik5	T	A	7: 25,023,064	D540V	possibly damaging	Het
Hint1	T	A	11: 54,869,943	D69E	probably benign	Het
Krt13	T	C	11: 100,119,385	T257A	probably benign	Het
Lrguk	A	G	6: 34,029,683	E76G	probably benign	Het
Lrrc8a	A	G	2: 30,256,298	M375V	probably benign	Het
Lrrtm3	T	C	10: 64,089,238	Q50R	possibly damaging	Het
Mmrn1	T	A	6: 60,976,529	L598Q	probably damaging	Het
Mrs2	A	G	13: 25,001,784	I135T	probably damaging	Het
Neb	T	C	2: 52,235,580	D475G		Het
Notch2	A	G	3: 98,135,599	S1427G	possibly damaging	Het
Olfr118	C	A	17: 37,672,411	Y129*	probably null	Het
Olfr682-ps1	A	G	7: 105,126,686	V195A	probably benign	Het
Olfr694	A	T	7: 106,689,089	I214N	probably damaging	Het
Olfr816	A	G	10: 129,911,862	C139R	probably damaging	Het
Olfr952	A	C	9: 39,426,219	V284G	possibly damaging	Het
Opcml	T	C	9: 28,902,151	F246S	probably damaging	Het
Pdzd2	C	A	15: 12,402,319	V729F	probably damaging	Het
Pias2	C	T	18: 77,146,768	Q565*	probably null	Het
Pnp	T	A	14: 50,950,720		probably null	Het
Ptpn18	T	C	1: 34,463,130	S76P	probably benign	Het
Qtrt2	A	T	16: 43,863,197	L304Q	probably damaging	Het
Rad51ap2	A	T	12: 11,457,400	E441V	possibly damaging	Het
Ranbp2	T	A	10: 58,477,889	V1477E	probably benign	Het
Repin1	C	T	6: 48,597,433	T432I	possibly damaging	Het
Rest	G	A	5: 77,282,511	G926R	probably benign	Het
Rnft1	T	A	11: 86,486,690	F143L	possibly damaging	Het
Sema3e	A	T	5: 14,232,094	I415L	probably benign	Het
Slc10a1	T	A	12: 80,967,595	N117I	probably damaging	Het
Slc25a23	G	A	17: 57,059,709		probably benign	Het
Slc2a2	T	C	3: 28,713,802	S160P	possibly damaging	Het
Srrd	A	G	5: 112,338,456	V178A	possibly damaging	Het
Tmigd3	G	T	3: 105,921,961	G198C	probably benign	Het
Trbv29	G	A	6: 41,271,405	M1I	probably null	Het
Tril	A	G	6: 53,819,584	S218P	probably damaging	Het
Trip11	T	C	12: 101,862,598	K1749R	probably benign	Het
Ttc25	G	T	11: 100,566,926	E452*	probably null	Het
Ttn	A	G	2: 76,830,651	V12011A		Het
Ubr4	T	G	4: 139,410,518	F1093V	probably benign	Het
Urb2	C	A	8: 124,028,403	A283E	probably benign	Het
Usp43	T	A	11: 67,898,881		probably benign	Het
Vmn1r28	A	T	6: 58,265,684	I171F	probably benign	Het
Vps33a	G	A	5: 123,533,899	R469W	probably damaging	Het
Zfp202	G	A	9: 40,211,757	R605Q	probably damaging	Het
Zpbp2	A	T	11: 98,554,620	H158L	probably benign	Het

Other mutations in Lpin2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Lpin2	APN	17	71243972	missense	probably damaging	1.00
IGL01712:Lpin2	APN	17	71215068	missense	probably damaging	1.00
IGL01727:Lpin2	APN	17	71246452	missense	probably damaging	1.00
IGL01969:Lpin2	APN	17	71231507	missense	probably benign	0.00
IGL02143:Lpin2	APN	17	71243926	missense	probably damaging	1.00
IGL02600:Lpin2	APN	17	71238698	missense	probably damaging	0.99
IGL02931:Lpin2	APN	17	71238683	missense	probably damaging	1.00
aspen	UTSW	17	71243970	nonsense	probably null
R1570_Lpin2_218	UTSW	17	71245181	nonsense	probably null
R0144:Lpin2	UTSW	17	71225076	missense	probably damaging	1.00
R0165:Lpin2	UTSW	17	71246519	missense	probably damaging	1.00
R0367:Lpin2	UTSW	17	71215022	missense	probably damaging	1.00
R0648:Lpin2	UTSW	17	71229312	missense	probably benign	0.01
R1564:Lpin2	UTSW	17	71225060	missense	probably benign	0.01
R1570:Lpin2	UTSW	17	71245181	nonsense	probably null
R1846:Lpin2	UTSW	17	71225069	missense	probably benign	0.00
R3607:Lpin2	UTSW	17	71229392	missense	probably damaging	1.00
R4006:Lpin2	UTSW	17	71246501	missense	probably damaging	1.00
R4526:Lpin2	UTSW	17	71237378	splice site	probably null
R4705:Lpin2	UTSW	17	71232143	unclassified	probably benign
R4949:Lpin2	UTSW	17	71231339	missense	probably damaging	1.00
R4970:Lpin2	UTSW	17	71231334	missense	probably damaging	0.98
R5099:Lpin2	UTSW	17	71243970	nonsense	probably null
R5100:Lpin2	UTSW	17	71243970	nonsense	probably null
R5101:Lpin2	UTSW	17	71243970	nonsense	probably null
R5152:Lpin2	UTSW	17	71245159	missense	probably damaging	1.00
R5216:Lpin2	UTSW	17	71242760	missense	probably damaging	1.00
R5321:Lpin2	UTSW	17	71246858	missense	probably damaging	1.00
R5457:Lpin2	UTSW	17	71243372	missense	probably damaging	1.00
R5695:Lpin2	UTSW	17	71244803	missense	probably damaging	1.00
R5786:Lpin2	UTSW	17	71230273	missense	probably benign	0.03
R5869:Lpin2	UTSW	17	71232276	unclassified	probably benign
R5894:Lpin2	UTSW	17	71246934	missense	probably benign	0.39
R6116:Lpin2	UTSW	17	71243930	missense	probably damaging	1.00
R6253:Lpin2	UTSW	17	71231269	missense	probably damaging	1.00
R6280:Lpin2	UTSW	17	71232248	unclassified	probably benign
R6443:Lpin2	UTSW	17	71241668	missense	probably benign	0.25
R6528:Lpin2	UTSW	17	71244005	missense	probably damaging	1.00
R6634:Lpin2	UTSW	17	71246418	missense	probably damaging	1.00
R6828:Lpin2	UTSW	17	71222128	missense	probably damaging	1.00
R6885:Lpin2	UTSW	17	71215150	missense	probably damaging	1.00
R6930:Lpin2	UTSW	17	71244791	missense	probably damaging	1.00
R7067:Lpin2	UTSW	17	71244858	missense	possibly damaging	0.72
R7583:Lpin2	UTSW	17	71231396	nonsense	probably null
R7806:Lpin2	UTSW	17	71245171	missense	probably damaging	1.00
R7840:Lpin2	UTSW	17	71230274	missense	probably benign	0.14
R8011:Lpin2	UTSW	17	71230375	missense	probably benign	0.43
R8553:Lpin2	UTSW	17	71231237	missense	probably damaging	1.00
R8947:Lpin2	UTSW	17	71204876	missense	probably benign	0.44
R8983:Lpin2	UTSW	17	71246967	missense	unknown
R9109:Lpin2	UTSW	17	71231521	critical splice donor site	probably null
R9184:Lpin2	UTSW	17	71233916	nonsense	probably null
R9242:Lpin2	UTSW	17	71246971	makesense	probably null
R9447:Lpin2	UTSW	17	71232092	missense	unknown
R9573:Lpin2	UTSW	17	71231190	missense	probably benign	0.00
R9603:Lpin2	UTSW	17	71243415	missense	probably damaging	1.00
R9666:Lpin2	UTSW	17	71222070	missense	probably damaging	1.00
Z1176:Lpin2	UTSW	17	71225211	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCTCATCAGTCAGATACACTGCC -3'
(R):5'- GGCATTGCTCTACTGTCCTG -3'

Sequencing Primer
(F):5'- AGTCAGATACACTGCCTGTTTG -3'
(R):5'- CTACTGTCCTGAGTCCTGAGAG -3'

Posted On

2021-07-15