Mutagenetix > Incidental Mutation

Incidental Mutation 'R8879:Ehd1'

676804

Institutional Source

Beutler Lab

Gene Symbol

Ehd1

Ensembl Gene

ENSMUSG00000024772

Gene Name

EH-domain containing 1

Synonyms

RME-1, Past1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8879 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

6276725-6300096 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 6298324 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 444 (D444G)

Ref Sequence

ENSEMBL: ENSMUSP00000025684 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025684]

AlphaFold

Q9WVK4

Predicted Effect

probably damaging
Transcript: ENSMUST00000025684
AA Change: D444G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000025684
Gene: ENSMUSG00000024772
AA Change: D444G

Domain	Start	End	E-Value	Type
Pfam:EHD_N	24	56	1.2e-19	PFAM
Pfam:MMR_HSR1	60	220	5.1e-9	PFAM
Pfam:Dynamin_N	61	221	6.6e-15	PFAM
low complexity region	420	433	N/A	INTRINSIC
EH	438	531	1.82e-45	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a highly conserved gene family encoding EPS15 homology (EH) domain-containing proteins. The protein-binding EH domain was first noted in EPS15, a substrate for the epidermal growth factor receptor. The EH domain has been shown to be an important motif in proteins involved in protein-protein interactions and in intracellular sorting. The protein encoded by this gene is thought to play a role in the endocytosis of IGF1 receptors. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show perinatal and postnatal lethality, decreased body weight, and male infertility due to defective spermatogenesis; female homozygotes may display malocclusion and variable ocular defects, including congenital central cataracts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130401M01Rik	C	T	15: 58,022,509	V326M	probably damaging	Het
Adap2	T	A	11: 80,156,959	H80Q	probably benign	Het
Ang4	T	C	14: 51,764,486	T2A	probably benign	Het
Arf2	T	C	11: 103,979,759		probably null	Het
B3gnt4	A	G	5: 123,511,148	D192G	probably damaging	Het
BC034090	T	C	1: 155,226,357	I54V	probably benign	Het
Catsper3	A	G	13: 55,804,895	T202A	probably benign	Het
Cenpe	T	A	3: 135,260,101	D2113E	probably damaging	Het
Clasp2	T	C	9: 113,773,705	V191A	probably benign	Het
Col5a1	G	T	2: 28,014,158	A1356S	unknown	Het
Cuzd1	A	G	7: 131,308,848	S573P	probably damaging	Het
Cyp1a2	C	A	9: 57,681,885	M215I	possibly damaging	Het
Dcaf17	T	A	2: 71,063,402	I122K	possibly damaging	Het
Dhcr24	A	G	4: 106,573,809	I232V	probably benign	Het
Dnah10	A	G	5: 124,818,117	E3570G	probably damaging	Het
Dnaja4	A	T	9: 54,714,704		probably benign	Het
Ehmt1	T	A	2: 24,836,476	M766L	possibly damaging	Het
Eno4	A	G	19: 58,970,722	I613M	probably benign	Het
Exoc3l	A	T	8: 105,290,549	M602K		Het
Fam107a	C	T	14: 8,301,352		probably null	Het
Frem3	A	T	8: 80,613,148	D690V	probably damaging	Het
Gm11639	T	C	11: 104,690,955	I41T	probably benign	Het
Gm19410	A	T	8: 35,771,868	D97V	probably damaging	Het
Grik5	T	A	7: 25,023,064	D540V	possibly damaging	Het
Hint1	T	A	11: 54,869,943	D69E	probably benign	Het
Krt13	T	C	11: 100,119,385	T257A	probably benign	Het
Lpin2	T	C	17: 71,242,754	L676P	probably damaging	Het
Lrguk	A	G	6: 34,029,683	E76G	probably benign	Het
Lrrc8a	A	G	2: 30,256,298	M375V	probably benign	Het
Lrrtm3	T	C	10: 64,089,238	Q50R	possibly damaging	Het
Mmrn1	T	A	6: 60,976,529	L598Q	probably damaging	Het
Mrs2	A	G	13: 25,001,784	I135T	probably damaging	Het
Neb	T	C	2: 52,235,580	D475G		Het
Notch2	A	G	3: 98,135,599	S1427G	possibly damaging	Het
Olfr118	C	A	17: 37,672,411	Y129*	probably null	Het
Olfr682-ps1	A	G	7: 105,126,686	V195A	probably benign	Het
Olfr694	A	T	7: 106,689,089	I214N	probably damaging	Het
Olfr816	A	G	10: 129,911,862	C139R	probably damaging	Het
Olfr952	A	C	9: 39,426,219	V284G	possibly damaging	Het
Opcml	T	C	9: 28,902,151	F246S	probably damaging	Het
Pdzd2	C	A	15: 12,402,319	V729F	probably damaging	Het
Pias2	C	T	18: 77,146,768	Q565*	probably null	Het
Pnp	T	A	14: 50,950,720		probably null	Het
Ptpn18	T	C	1: 34,463,130	S76P	probably benign	Het
Qtrt2	A	T	16: 43,863,197	L304Q	probably damaging	Het
Rad51ap2	A	T	12: 11,457,400	E441V	possibly damaging	Het
Ranbp2	T	A	10: 58,477,889	V1477E	probably benign	Het
Repin1	C	T	6: 48,597,433	T432I	possibly damaging	Het
Rest	G	A	5: 77,282,511	G926R	probably benign	Het
Rnft1	T	A	11: 86,486,690	F143L	possibly damaging	Het
Sema3e	A	T	5: 14,232,094	I415L	probably benign	Het
Slc10a1	T	A	12: 80,967,595	N117I	probably damaging	Het
Slc25a23	G	A	17: 57,059,709		probably benign	Het
Slc2a2	T	C	3: 28,713,802	S160P	possibly damaging	Het
Srrd	A	G	5: 112,338,456	V178A	possibly damaging	Het
Tmigd3	G	T	3: 105,921,961	G198C	probably benign	Het
Trbv29	G	A	6: 41,271,405	M1I	probably null	Het
Tril	A	G	6: 53,819,584	S218P	probably damaging	Het
Trip11	T	C	12: 101,862,598	K1749R	probably benign	Het
Ttc25	G	T	11: 100,566,926	E452*	probably null	Het
Ttn	A	G	2: 76,830,651	V12011A		Het
Ubr4	T	G	4: 139,410,518	F1093V	probably benign	Het
Urb2	C	A	8: 124,028,403	A283E	probably benign	Het
Usp43	T	A	11: 67,898,881		probably benign	Het
Vmn1r28	A	T	6: 58,265,684	I171F	probably benign	Het
Vps33a	G	A	5: 123,533,899	R469W	probably damaging	Het
Zfp202	G	A	9: 40,211,757	R605Q	probably damaging	Het
Zpbp2	A	T	11: 98,554,620	H158L	probably benign	Het

Other mutations in Ehd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01109:Ehd1	APN	19	6298147	missense	possibly damaging	0.86
IGL02573:Ehd1	APN	19	6294300	missense	probably damaging	1.00
IGL03146:Ehd1	APN	19	6277338	missense	probably damaging	1.00
declining	UTSW	19	6294388	missense	probably damaging	1.00
R1376:Ehd1	UTSW	19	6294388	missense	probably damaging	1.00
R1376:Ehd1	UTSW	19	6294388	missense	probably damaging	1.00
R1593:Ehd1	UTSW	19	6298300	missense
R2062:Ehd1	UTSW	19	6298078	missense	probably benign	0.11
R2064:Ehd1	UTSW	19	6298078	missense	probably benign	0.11
R2065:Ehd1	UTSW	19	6298078	missense	probably benign	0.11
R2066:Ehd1	UTSW	19	6298078	missense	probably benign	0.11
R2067:Ehd1	UTSW	19	6298078	missense	probably benign	0.11
R2068:Ehd1	UTSW	19	6298078	missense	probably benign	0.11
R2217:Ehd1	UTSW	19	6298472	missense	probably damaging	1.00
R3436:Ehd1	UTSW	19	6277014	nonsense	probably null
R3705:Ehd1	UTSW	19	6298300	missense
R4654:Ehd1	UTSW	19	6276964	utr 5 prime	probably benign
R4902:Ehd1	UTSW	19	6294243	missense	possibly damaging	0.91
R5001:Ehd1	UTSW	19	6297694	missense	probably benign	0.14
R5076:Ehd1	UTSW	19	6277221	missense	probably benign	0.02
R6327:Ehd1	UTSW	19	6298345	missense	possibly damaging	0.81
R6679:Ehd1	UTSW	19	6294444	missense	probably benign	0.01
R7120:Ehd1	UTSW	19	6297561	missense	probably benign	0.00
R7183:Ehd1	UTSW	19	6297654	missense	probably benign	0.02
R7215:Ehd1	UTSW	19	6297642	missense	possibly damaging	0.81
R7853:Ehd1	UTSW	19	6277195	missense	probably damaging	0.99
R8467:Ehd1	UTSW	19	6281288	missense	probably benign	0.24
R8523:Ehd1	UTSW	19	6294583	missense	probably damaging	0.98
R8957:Ehd1	UTSW	19	6294409	missense	probably damaging	1.00
R9011:Ehd1	UTSW	19	6298078	missense	probably benign	0.11
R9664:Ehd1	UTSW	19	6281232	missense	probably benign	0.01
R9687:Ehd1	UTSW	19	6298300	missense

Predicted Primers

PCR Primer
(F):5'- CAGCAAGTTCCAGGCCTTGAAG -3'
(R):5'- GCAAACTCCTCGTCATCCAG -3'

Sequencing Primer
(F):5'- GATATGCTGGCCAACGATATAGCTC -3'
(R):5'- ATCCAGCAGGCCATCCTTG -3'

Posted On

2021-07-15