Incidental Mutation 'R8879:Ehd1'
ID 676804
Institutional Source Beutler Lab
Gene Symbol Ehd1
Ensembl Gene ENSMUSG00000024772
Gene Name EH-domain containing 1
Synonyms RME-1, Past1
MMRRC Submission 068747-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8879 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 6326926-6350126 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 6348354 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 444 (D444G)
Ref Sequence ENSEMBL: ENSMUSP00000025684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025684]
AlphaFold Q9WVK4
Predicted Effect probably damaging
Transcript: ENSMUST00000025684
AA Change: D444G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025684
Gene: ENSMUSG00000024772
AA Change: D444G

DomainStartEndE-ValueType
Pfam:EHD_N 24 56 1.2e-19 PFAM
Pfam:MMR_HSR1 60 220 5.1e-9 PFAM
Pfam:Dynamin_N 61 221 6.6e-15 PFAM
low complexity region 420 433 N/A INTRINSIC
EH 438 531 1.82e-45 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a highly conserved gene family encoding EPS15 homology (EH) domain-containing proteins. The protein-binding EH domain was first noted in EPS15, a substrate for the epidermal growth factor receptor. The EH domain has been shown to be an important motif in proteins involved in protein-protein interactions and in intracellular sorting. The protein encoded by this gene is thought to play a role in the endocytosis of IGF1 receptors. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show perinatal and postnatal lethality, decreased body weight, and male infertility due to defective spermatogenesis; female homozygotes may display malocclusion and variable ocular defects, including congenital central cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C T 15: 57,885,905 (GRCm39) V326M probably damaging Het
Adap2 T A 11: 80,047,785 (GRCm39) H80Q probably benign Het
Ang4 T C 14: 52,001,943 (GRCm39) T2A probably benign Het
Arf2 T C 11: 103,870,585 (GRCm39) probably null Het
B3gnt4 A G 5: 123,649,211 (GRCm39) D192G probably damaging Het
BC034090 T C 1: 155,102,103 (GRCm39) I54V probably benign Het
Catsper3 A G 13: 55,952,708 (GRCm39) T202A probably benign Het
Cenpe T A 3: 134,965,862 (GRCm39) D2113E probably damaging Het
Clasp2 T C 9: 113,602,773 (GRCm39) V191A probably benign Het
Col5a1 G T 2: 27,904,170 (GRCm39) A1356S unknown Het
Cuzd1 A G 7: 130,910,577 (GRCm39) S573P probably damaging Het
Cyp1a2 C A 9: 57,589,168 (GRCm39) M215I possibly damaging Het
Dcaf17 T A 2: 70,893,746 (GRCm39) I122K possibly damaging Het
Dhcr24 A G 4: 106,431,006 (GRCm39) I232V probably benign Het
Dnah10 A G 5: 124,895,181 (GRCm39) E3570G probably damaging Het
Dnaja4 A T 9: 54,621,988 (GRCm39) probably benign Het
Efcab3 T C 11: 104,581,781 (GRCm39) I41T probably benign Het
Ehmt1 T A 2: 24,726,488 (GRCm39) M766L possibly damaging Het
Eno4 A G 19: 58,959,154 (GRCm39) I613M probably benign Het
Exoc3l A T 8: 106,017,181 (GRCm39) M602K Het
Fam107a C T 14: 8,301,352 (GRCm38) probably null Het
Frem3 A T 8: 81,339,777 (GRCm39) D690V probably damaging Het
Gm19410 A T 8: 36,239,022 (GRCm39) D97V probably damaging Het
Grik5 T A 7: 24,722,489 (GRCm39) D540V possibly damaging Het
Hint1 T A 11: 54,760,769 (GRCm39) D69E probably benign Het
Krt13 T C 11: 100,010,211 (GRCm39) T257A probably benign Het
Lpin2 T C 17: 71,549,749 (GRCm39) L676P probably damaging Het
Lrguk A G 6: 34,006,618 (GRCm39) E76G probably benign Het
Lrrc8a A G 2: 30,146,310 (GRCm39) M375V probably benign Het
Lrrtm3 T C 10: 63,925,017 (GRCm39) Q50R possibly damaging Het
Mmrn1 T A 6: 60,953,513 (GRCm39) L598Q probably damaging Het
Mrs2 A G 13: 25,185,767 (GRCm39) I135T probably damaging Het
Neb T C 2: 52,125,592 (GRCm39) D475G Het
Notch2 A G 3: 98,042,915 (GRCm39) S1427G possibly damaging Het
Odad4 G T 11: 100,457,752 (GRCm39) E452* probably null Het
Opcml T C 9: 28,813,447 (GRCm39) F246S probably damaging Het
Or10al2 C A 17: 37,983,302 (GRCm39) Y129* probably null Het
Or2ag1b A T 7: 106,288,296 (GRCm39) I214N probably damaging Het
Or56a42-ps1 A G 7: 104,775,893 (GRCm39) V195A probably benign Het
Or6c69 A G 10: 129,747,731 (GRCm39) C139R probably damaging Het
Or8g33 A C 9: 39,337,515 (GRCm39) V284G possibly damaging Het
Pdzd2 C A 15: 12,402,405 (GRCm39) V729F probably damaging Het
Pias2 C T 18: 77,234,464 (GRCm39) Q565* probably null Het
Pnp T A 14: 51,188,177 (GRCm39) probably null Het
Ptpn18 T C 1: 34,502,211 (GRCm39) S76P probably benign Het
Qtrt2 A T 16: 43,683,560 (GRCm39) L304Q probably damaging Het
Rad51ap2 A T 12: 11,507,401 (GRCm39) E441V possibly damaging Het
Ranbp2 T A 10: 58,313,711 (GRCm39) V1477E probably benign Het
Repin1 C T 6: 48,574,367 (GRCm39) T432I possibly damaging Het
Rest G A 5: 77,430,358 (GRCm39) G926R probably benign Het
Rnft1 T A 11: 86,377,516 (GRCm39) F143L possibly damaging Het
Sema3e A T 5: 14,282,108 (GRCm39) I415L probably benign Het
Slc10a1 T A 12: 81,014,369 (GRCm39) N117I probably damaging Het
Slc25a23 G A 17: 57,366,709 (GRCm39) probably benign Het
Slc2a2 T C 3: 28,767,951 (GRCm39) S160P possibly damaging Het
Srrd A G 5: 112,486,322 (GRCm39) V178A possibly damaging Het
Tmigd3 G T 3: 105,829,277 (GRCm39) G198C probably benign Het
Trbv28 G A 6: 41,248,339 (GRCm39) M1I probably null Het
Tril A G 6: 53,796,569 (GRCm39) S218P probably damaging Het
Trip11 T C 12: 101,828,857 (GRCm39) K1749R probably benign Het
Ttn A G 2: 76,660,995 (GRCm39) V12011A Het
Ubr4 T G 4: 139,137,829 (GRCm39) F1093V probably benign Het
Urb2 C A 8: 124,755,142 (GRCm39) A283E probably benign Het
Usp43 T A 11: 67,789,707 (GRCm39) probably benign Het
Vmn1r28 A T 6: 58,242,669 (GRCm39) I171F probably benign Het
Vps33a G A 5: 123,671,962 (GRCm39) R469W probably damaging Het
Zfp202 G A 9: 40,123,053 (GRCm39) R605Q probably damaging Het
Zpbp2 A T 11: 98,445,446 (GRCm39) H158L probably benign Het
Other mutations in Ehd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Ehd1 APN 19 6,348,177 (GRCm39) missense possibly damaging 0.86
IGL02573:Ehd1 APN 19 6,344,330 (GRCm39) missense probably damaging 1.00
IGL03146:Ehd1 APN 19 6,327,368 (GRCm39) missense probably damaging 1.00
declining UTSW 19 6,344,418 (GRCm39) missense probably damaging 1.00
R1376:Ehd1 UTSW 19 6,344,418 (GRCm39) missense probably damaging 1.00
R1376:Ehd1 UTSW 19 6,344,418 (GRCm39) missense probably damaging 1.00
R1593:Ehd1 UTSW 19 6,348,330 (GRCm39) missense
R2062:Ehd1 UTSW 19 6,348,108 (GRCm39) missense probably benign 0.11
R2064:Ehd1 UTSW 19 6,348,108 (GRCm39) missense probably benign 0.11
R2065:Ehd1 UTSW 19 6,348,108 (GRCm39) missense probably benign 0.11
R2066:Ehd1 UTSW 19 6,348,108 (GRCm39) missense probably benign 0.11
R2067:Ehd1 UTSW 19 6,348,108 (GRCm39) missense probably benign 0.11
R2068:Ehd1 UTSW 19 6,348,108 (GRCm39) missense probably benign 0.11
R2217:Ehd1 UTSW 19 6,348,502 (GRCm39) missense probably damaging 1.00
R3436:Ehd1 UTSW 19 6,327,044 (GRCm39) nonsense probably null
R3705:Ehd1 UTSW 19 6,348,330 (GRCm39) missense
R4654:Ehd1 UTSW 19 6,326,994 (GRCm39) utr 5 prime probably benign
R4902:Ehd1 UTSW 19 6,344,273 (GRCm39) missense possibly damaging 0.91
R5001:Ehd1 UTSW 19 6,347,724 (GRCm39) missense probably benign 0.14
R5076:Ehd1 UTSW 19 6,327,251 (GRCm39) missense probably benign 0.02
R6327:Ehd1 UTSW 19 6,348,375 (GRCm39) missense possibly damaging 0.81
R6679:Ehd1 UTSW 19 6,344,474 (GRCm39) missense probably benign 0.01
R7120:Ehd1 UTSW 19 6,347,591 (GRCm39) missense probably benign 0.00
R7183:Ehd1 UTSW 19 6,347,684 (GRCm39) missense probably benign 0.02
R7215:Ehd1 UTSW 19 6,347,672 (GRCm39) missense possibly damaging 0.81
R7853:Ehd1 UTSW 19 6,327,225 (GRCm39) missense probably damaging 0.99
R8467:Ehd1 UTSW 19 6,331,318 (GRCm39) missense probably benign 0.24
R8523:Ehd1 UTSW 19 6,344,613 (GRCm39) missense probably damaging 0.98
R8957:Ehd1 UTSW 19 6,344,439 (GRCm39) missense probably damaging 1.00
R9011:Ehd1 UTSW 19 6,348,108 (GRCm39) missense probably benign 0.11
R9664:Ehd1 UTSW 19 6,331,262 (GRCm39) missense probably benign 0.01
R9687:Ehd1 UTSW 19 6,348,330 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- CAGCAAGTTCCAGGCCTTGAAG -3'
(R):5'- GCAAACTCCTCGTCATCCAG -3'

Sequencing Primer
(F):5'- GATATGCTGGCCAACGATATAGCTC -3'
(R):5'- ATCCAGCAGGCCATCCTTG -3'
Posted On 2021-07-15