Incidental Mutation 'R8880:St18'
ID 676806
Institutional Source Beutler Lab
Gene Symbol St18
Ensembl Gene ENSMUSG00000033740
Gene Name suppression of tumorigenicity 18
Synonyms Nzf3, Myt3
MMRRC Submission 068748-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8880 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 6557455-6931164 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 6865619 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 32 (Y32*)
Ref Sequence ENSEMBL: ENSMUSP00000042056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043578] [ENSMUST00000131467] [ENSMUST00000131494] [ENSMUST00000139756] [ENSMUST00000139838] [ENSMUST00000140079] [ENSMUST00000150761] [ENSMUST00000151281] [ENSMUST00000163727]
AlphaFold Q80TY4
Predicted Effect probably null
Transcript: ENSMUST00000043578
AA Change: Y32*
SMART Domains Protein: ENSMUSP00000042056
Gene: ENSMUSG00000033740
AA Change: Y32*

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 365 392 7.8e-15 PFAM
Pfam:zf-C2HC 409 437 4.2e-17 PFAM
Pfam:MYT1 476 713 1.3e-75 PFAM
Pfam:zf-C2HC 721 749 4e-19 PFAM
Pfam:zf-C2HC 765 793 1.7e-19 PFAM
Pfam:zf-C2HC 813 841 1.1e-17 PFAM
Pfam:zf-C2HC 866 893 9.1e-15 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000131467
AA Change: Y32*
Predicted Effect probably null
Transcript: ENSMUST00000131494
AA Change: Y32*
SMART Domains Protein: ENSMUSP00000117789
Gene: ENSMUSG00000033740
AA Change: Y32*

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000139756
AA Change: Y32*
Predicted Effect probably null
Transcript: ENSMUST00000139838
AA Change: Y32*
SMART Domains Protein: ENSMUSP00000118129
Gene: ENSMUSG00000033740
AA Change: Y32*

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000140079
AA Change: Y32*
SMART Domains Protein: ENSMUSP00000118322
Gene: ENSMUSG00000033740
AA Change: Y32*

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000150761
AA Change: Y32*
SMART Domains Protein: ENSMUSP00000120298
Gene: ENSMUSG00000033740
AA Change: Y32*

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000151281
AA Change: Y32*
SMART Domains Protein: ENSMUSP00000122055
Gene: ENSMUSG00000033740
AA Change: Y32*

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163727
AA Change: Y32*
SMART Domains Protein: ENSMUSP00000131417
Gene: ENSMUSG00000033740
AA Change: Y32*

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 365 392 7.8e-15 PFAM
Pfam:zf-C2HC 409 437 4.2e-17 PFAM
Pfam:MYT1 476 713 1.3e-75 PFAM
Pfam:zf-C2HC 721 749 4e-19 PFAM
Pfam:zf-C2HC 765 793 1.7e-19 PFAM
Pfam:zf-C2HC 813 841 1.1e-17 PFAM
Pfam:zf-C2HC 866 893 9.1e-15 PFAM
coiled coil region 918 987 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (82/82)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik C T 14: 32,382,837 (GRCm39) V1043I probably benign Het
5031439G07Rik T A 15: 84,839,867 (GRCm39) I176F possibly damaging Het
Adam6b T A 12: 113,454,764 (GRCm39) M527K probably benign Het
Atp10b C T 11: 43,106,811 (GRCm39) T615I probably benign Het
Atxn2 A G 5: 121,948,973 (GRCm39) T1117A probably benign Het
AU021092 A T 16: 5,032,585 (GRCm39) probably benign Het
Bcam C T 7: 19,492,671 (GRCm39) V505M probably damaging Het
Bco2 A T 9: 50,461,962 (GRCm39) L14Q probably damaging Het
Caps2 T G 10: 112,030,824 (GRCm39) probably benign Het
Cblb T C 16: 51,986,368 (GRCm39) V537A probably benign Het
Ccdc141 A T 2: 76,845,556 (GRCm39) N1170K probably benign Het
Ccdc154 T G 17: 25,389,129 (GRCm39) D442E probably benign Het
Col24a1 A G 3: 145,019,798 (GRCm39) I60V probably null Het
Crb1 A T 1: 139,164,886 (GRCm39) N1140K probably benign Het
Ddhd1 G A 14: 45,846,430 (GRCm39) P621S probably benign Het
Ddx46 A T 13: 55,814,033 (GRCm39) N663I probably benign Het
Dgki C T 6: 37,011,652 (GRCm39) probably benign Het
Disp2 T C 2: 118,621,239 (GRCm39) F657S probably damaging Het
Dnajc2 T C 5: 21,973,670 (GRCm39) E262G probably damaging Het
Dvl2 T A 11: 69,898,761 (GRCm39) L408Q possibly damaging Het
Egflam T C 15: 7,267,249 (GRCm39) D712G probably damaging Het
Entpd7 A G 19: 43,692,846 (GRCm39) probably benign Het
Epb41 A T 4: 131,695,104 (GRCm39) W28R Het
Fabp9 C T 3: 10,262,231 (GRCm39) probably benign Het
Fkbp15 T A 4: 62,232,602 (GRCm39) M657L probably benign Het
Gfy A C 7: 44,827,784 (GRCm39) L104R possibly damaging Het
Gm4884 A T 7: 40,693,911 (GRCm39) I627F probably damaging Het
Gm9195 A T 14: 72,691,320 (GRCm39) S1643T unknown Het
Gpsm2 C T 3: 108,610,335 (GRCm39) A42T possibly damaging Het
Gvin2 T C 7: 105,551,120 (GRCm39) K644R probably benign Het
Gys2 T C 6: 142,402,113 (GRCm39) Y242C probably damaging Het
Hbs1l A G 10: 21,185,868 (GRCm39) N430S probably damaging Het
Idh3b A T 2: 130,126,004 (GRCm39) probably benign Het
Igdcc3 C T 9: 65,088,550 (GRCm39) A384V probably benign Het
Ighv3-4 C T 12: 114,217,535 (GRCm39) D19N possibly damaging Het
Igkv19-93 G T 6: 68,713,494 (GRCm39) A45E probably damaging Het
Il10ra G A 9: 45,175,631 (GRCm39) T230M probably damaging Het
Kalrn A G 16: 34,038,305 (GRCm39) V1009A probably damaging Het
Kcnma1 G T 14: 23,417,718 (GRCm39) A837D probably damaging Het
Kif7 T A 7: 79,348,650 (GRCm39) R1231S probably benign Het
Klhdc1 A G 12: 69,298,817 (GRCm39) D134G possibly damaging Het
Klk14 T C 7: 43,343,459 (GRCm39) V97A probably damaging Het
Lamb3 G A 1: 193,003,363 (GRCm39) V101M possibly damaging Het
Lrrc7 C T 3: 157,867,381 (GRCm39) E787K probably damaging Het
Mep1a A G 17: 43,808,808 (GRCm39) I94T possibly damaging Het
Mtrex T A 13: 113,051,034 (GRCm39) K180N probably benign Het
Ncr1 C T 7: 4,341,336 (GRCm39) S109L probably benign Het
Nell2 A T 15: 95,129,329 (GRCm39) M678K probably damaging Het
Or12j5 C A 7: 140,084,172 (GRCm39) A67S probably benign Het
Or14c42-ps1 G A 7: 86,211,549 (GRCm39) C203Y unknown Het
Or2m13 A T 16: 19,226,396 (GRCm39) Y123* probably null Het
Or8g19 T A 9: 39,055,899 (GRCm39) F168I probably damaging Het
Pnpla1 A C 17: 29,098,438 (GRCm39) Y248S probably damaging Het
Pramel27 T C 4: 143,573,140 (GRCm39) probably null Het
Prdm10 T C 9: 31,264,742 (GRCm39) F726L probably damaging Het
Prdm16 T C 4: 154,613,370 (GRCm39) N19S probably damaging Het
Prss44 A G 9: 110,643,263 (GRCm39) R53G probably benign Het
Rasgrp1 C T 2: 117,115,425 (GRCm39) R721Q probably benign Het
Rassf1 A T 9: 107,434,740 (GRCm39) N149I probably damaging Het
Rbp3 A C 14: 33,678,796 (GRCm39) T915P probably benign Het
Reg3g A T 6: 78,444,788 (GRCm39) D63E probably benign Het
Relch T C 1: 105,592,220 (GRCm39) Y130H probably damaging Het
Rgs3 C A 4: 62,543,373 (GRCm39) T236K probably damaging Het
Rin2 T C 2: 145,690,772 (GRCm39) F147L probably damaging Het
Slc17a1 T C 13: 24,062,732 (GRCm39) I266T probably benign Het
Slc34a3 A T 2: 25,119,267 (GRCm39) N534K probably benign Het
Smc2 A T 4: 52,462,856 (GRCm39) E615D probably benign Het
Snx16 A C 3: 10,484,193 (GRCm39) D343E probably benign Het
Svep1 C T 4: 58,064,204 (GRCm39) V3260I possibly damaging Het
Synm C T 7: 67,386,456 (GRCm39) R402H possibly damaging Het
Tacc2 A T 7: 130,318,564 (GRCm39) E67V possibly damaging Het
Tarbp1 G T 8: 127,198,044 (GRCm39) N302K probably damaging Het
Tenm2 A G 11: 35,942,788 (GRCm39) S1294P probably damaging Het
Ttk T C 9: 83,751,304 (GRCm39) S794P probably damaging Het
Ulk1 G A 5: 110,934,288 (GRCm39) A999V probably damaging Het
Upf2 A G 2: 6,030,983 (GRCm39) I808V unknown Het
Ush2a A G 1: 188,460,733 (GRCm39) T2665A probably benign Het
Usp8 A G 2: 126,590,229 (GRCm39) K672E probably damaging Het
Vmn2r105 T A 17: 20,429,229 (GRCm39) I616F probably damaging Het
Vps33a T C 5: 123,707,506 (GRCm39) M154V probably damaging Het
Wdfy4 A C 14: 32,795,492 (GRCm39) Y2083* probably null Het
Zc3hav1 A G 6: 38,288,212 (GRCm39) F875L probably benign Het
Zfp979 T C 4: 147,697,836 (GRCm39) N291S probably benign Het
Zp2 T A 7: 119,742,835 (GRCm39) Y99F possibly damaging Het
Other mutations in St18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:St18 APN 1 6,872,796 (GRCm39) missense probably benign 0.07
IGL00840:St18 APN 1 6,903,818 (GRCm39) missense probably damaging 1.00
IGL01016:St18 APN 1 6,914,547 (GRCm39) missense probably damaging 0.98
IGL01116:St18 APN 1 6,872,856 (GRCm39) missense probably damaging 0.96
IGL01719:St18 APN 1 6,916,020 (GRCm39) splice site probably benign
IGL01885:St18 APN 1 6,914,596 (GRCm39) critical splice donor site probably null
IGL02486:St18 APN 1 6,890,307 (GRCm39) missense probably damaging 1.00
IGL02611:St18 APN 1 6,839,114 (GRCm39) splice site probably benign
IGL02742:St18 APN 1 6,872,540 (GRCm39) splice site probably benign
IGL02953:St18 APN 1 6,914,337 (GRCm39) splice site probably benign
IGL02999:St18 APN 1 6,887,829 (GRCm39) missense probably benign 0.01
IGL03092:St18 APN 1 6,839,118 (GRCm39) splice site probably benign
Smallish UTSW 1 6,925,697 (GRCm39) critical splice donor site probably null
IGL03055:St18 UTSW 1 6,872,959 (GRCm39) missense probably damaging 0.99
R0089:St18 UTSW 1 6,919,172 (GRCm39) missense probably benign 0.02
R0257:St18 UTSW 1 6,890,186 (GRCm39) missense probably benign 0.04
R0383:St18 UTSW 1 6,873,248 (GRCm39) missense probably damaging 1.00
R0588:St18 UTSW 1 6,887,962 (GRCm39) missense probably damaging 0.99
R0989:St18 UTSW 1 6,898,105 (GRCm39) missense probably benign 0.04
R1068:St18 UTSW 1 6,865,786 (GRCm39) missense probably benign 0.01
R1311:St18 UTSW 1 6,915,868 (GRCm39) missense probably damaging 1.00
R1530:St18 UTSW 1 6,915,793 (GRCm39) critical splice acceptor site probably null
R1723:St18 UTSW 1 6,880,909 (GRCm39) splice site probably benign
R1926:St18 UTSW 1 6,872,913 (GRCm39) missense probably benign 0.00
R1927:St18 UTSW 1 6,872,936 (GRCm39) missense probably benign 0.00
R2035:St18 UTSW 1 6,872,552 (GRCm39) missense probably benign 0.00
R2091:St18 UTSW 1 6,898,195 (GRCm39) missense probably benign 0.08
R2139:St18 UTSW 1 6,880,839 (GRCm39) missense possibly damaging 0.85
R2261:St18 UTSW 1 6,915,796 (GRCm39) missense probably damaging 0.96
R2300:St18 UTSW 1 6,925,626 (GRCm39) missense probably damaging 1.00
R2322:St18 UTSW 1 6,914,348 (GRCm39) nonsense probably null
R2846:St18 UTSW 1 6,915,811 (GRCm39) missense probably damaging 0.96
R3738:St18 UTSW 1 6,925,697 (GRCm39) critical splice donor site probably null
R3739:St18 UTSW 1 6,925,697 (GRCm39) critical splice donor site probably null
R3772:St18 UTSW 1 6,914,553 (GRCm39) missense probably damaging 1.00
R3805:St18 UTSW 1 6,872,577 (GRCm39) missense probably damaging 1.00
R3953:St18 UTSW 1 6,873,117 (GRCm39) missense probably damaging 0.99
R4034:St18 UTSW 1 6,925,697 (GRCm39) critical splice donor site probably null
R4036:St18 UTSW 1 6,898,010 (GRCm39) missense probably damaging 1.00
R4407:St18 UTSW 1 6,898,061 (GRCm39) missense probably benign 0.29
R4527:St18 UTSW 1 6,925,647 (GRCm39) missense probably damaging 1.00
R4740:St18 UTSW 1 6,887,828 (GRCm39) missense probably benign
R4838:St18 UTSW 1 6,873,129 (GRCm39) missense probably benign 0.01
R5182:St18 UTSW 1 6,887,877 (GRCm39) missense probably benign 0.03
R5186:St18 UTSW 1 6,872,541 (GRCm39) splice site probably null
R5354:St18 UTSW 1 6,914,395 (GRCm39) missense probably damaging 1.00
R5423:St18 UTSW 1 6,872,840 (GRCm39) missense possibly damaging 0.91
R5724:St18 UTSW 1 6,841,174 (GRCm39) missense probably benign 0.13
R6182:St18 UTSW 1 6,914,342 (GRCm39) splice site probably null
R6491:St18 UTSW 1 6,898,209 (GRCm39) nonsense probably null
R6503:St18 UTSW 1 6,865,621 (GRCm39) missense probably damaging 1.00
R7037:St18 UTSW 1 6,873,260 (GRCm39) missense possibly damaging 0.65
R7098:St18 UTSW 1 6,898,066 (GRCm39) missense probably damaging 1.00
R7132:St18 UTSW 1 6,929,351 (GRCm39) missense
R7144:St18 UTSW 1 6,903,818 (GRCm39) missense probably damaging 1.00
R7150:St18 UTSW 1 6,873,243 (GRCm39) missense probably damaging 1.00
R7334:St18 UTSW 1 6,872,783 (GRCm39) missense probably benign 0.00
R7502:St18 UTSW 1 6,898,194 (GRCm39) missense probably benign 0.09
R7729:St18 UTSW 1 6,872,761 (GRCm39) missense probably benign 0.00
R7848:St18 UTSW 1 6,927,669 (GRCm39) critical splice donor site probably null
R8088:St18 UTSW 1 6,898,229 (GRCm39) missense probably benign 0.00
R8299:St18 UTSW 1 6,873,216 (GRCm39) missense probably benign 0.01
R8338:St18 UTSW 1 6,879,516 (GRCm39) missense probably damaging 1.00
R8690:St18 UTSW 1 6,872,788 (GRCm39) missense probably benign
R8753:St18 UTSW 1 6,916,015 (GRCm39) missense probably damaging 1.00
R8808:St18 UTSW 1 6,880,826 (GRCm39) missense probably damaging 1.00
R9055:St18 UTSW 1 6,873,206 (GRCm39) nonsense probably null
R9292:St18 UTSW 1 6,898,106 (GRCm39) missense probably benign 0.32
R9322:St18 UTSW 1 6,865,747 (GRCm39) missense probably benign 0.00
R9530:St18 UTSW 1 6,872,997 (GRCm39) missense probably benign 0.00
R9603:St18 UTSW 1 6,915,811 (GRCm39) missense probably damaging 1.00
R9611:St18 UTSW 1 6,873,147 (GRCm39) missense probably benign 0.00
R9639:St18 UTSW 1 6,929,246 (GRCm39) missense
R9644:St18 UTSW 1 6,929,276 (GRCm39) missense
R9740:St18 UTSW 1 6,873,287 (GRCm39) nonsense probably null
R9750:St18 UTSW 1 6,873,216 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TACCCGGGAGTAATGGTGAG -3'
(R):5'- GCTTGGACCATGCCTTTTG -3'

Sequencing Primer
(F):5'- TGAGTTTTTAAATACTTCTGGTGGAC -3'
(R):5'- GGACCATGCCTTTTGCTACCTG -3'
Posted On 2021-07-15