Incidental Mutation 'R8880:St18'
ID 676806
Institutional Source Beutler Lab
Gene Symbol St18
Ensembl Gene ENSMUSG00000033740
Gene Name suppression of tumorigenicity 18
Synonyms Nzf3, Myt3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8880 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 6487231-6860940 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 6795395 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 32 (Y32*)
Ref Sequence ENSEMBL: ENSMUSP00000042056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043578] [ENSMUST00000131467] [ENSMUST00000131494] [ENSMUST00000139756] [ENSMUST00000139838] [ENSMUST00000140079] [ENSMUST00000150761] [ENSMUST00000151281] [ENSMUST00000163727]
AlphaFold Q80TY4
Predicted Effect probably null
Transcript: ENSMUST00000043578
AA Change: Y32*
SMART Domains Protein: ENSMUSP00000042056
Gene: ENSMUSG00000033740
AA Change: Y32*

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 365 392 7.8e-15 PFAM
Pfam:zf-C2HC 409 437 4.2e-17 PFAM
Pfam:MYT1 476 713 1.3e-75 PFAM
Pfam:zf-C2HC 721 749 4e-19 PFAM
Pfam:zf-C2HC 765 793 1.7e-19 PFAM
Pfam:zf-C2HC 813 841 1.1e-17 PFAM
Pfam:zf-C2HC 866 893 9.1e-15 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000131467
AA Change: Y32*
Predicted Effect probably null
Transcript: ENSMUST00000131494
AA Change: Y32*
SMART Domains Protein: ENSMUSP00000117789
Gene: ENSMUSG00000033740
AA Change: Y32*

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000139756
AA Change: Y32*
Predicted Effect probably null
Transcript: ENSMUST00000139838
AA Change: Y32*
SMART Domains Protein: ENSMUSP00000118129
Gene: ENSMUSG00000033740
AA Change: Y32*

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000140079
AA Change: Y32*
SMART Domains Protein: ENSMUSP00000118322
Gene: ENSMUSG00000033740
AA Change: Y32*

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000150761
AA Change: Y32*
SMART Domains Protein: ENSMUSP00000120298
Gene: ENSMUSG00000033740
AA Change: Y32*

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000151281
AA Change: Y32*
SMART Domains Protein: ENSMUSP00000122055
Gene: ENSMUSG00000033740
AA Change: Y32*

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163727
AA Change: Y32*
SMART Domains Protein: ENSMUSP00000131417
Gene: ENSMUSG00000033740
AA Change: Y32*

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 365 392 7.8e-15 PFAM
Pfam:zf-C2HC 409 437 4.2e-17 PFAM
Pfam:MYT1 476 713 1.3e-75 PFAM
Pfam:zf-C2HC 721 749 4e-19 PFAM
Pfam:zf-C2HC 765 793 1.7e-19 PFAM
Pfam:zf-C2HC 813 841 1.1e-17 PFAM
Pfam:zf-C2HC 866 893 9.1e-15 PFAM
coiled coil region 918 987 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (82/82)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,664,495 Y130H probably damaging Het
3425401B19Rik C T 14: 32,660,880 V1043I probably benign Het
5031439G07Rik T A 15: 84,955,666 I176F possibly damaging Het
Adam6b T A 12: 113,491,144 M527K probably benign Het
Atp10b C T 11: 43,215,984 T615I probably benign Het
Atxn2 A G 5: 121,810,910 T1117A probably benign Het
AU021092 A T 16: 5,214,721 probably benign Het
Bcam C T 7: 19,758,746 V505M probably damaging Het
Bco2 A T 9: 50,550,662 L14Q probably damaging Het
Caps2 T G 10: 112,194,919 probably benign Het
Cblb T C 16: 52,166,005 V537A probably benign Het
Ccdc141 A T 2: 77,015,212 N1170K probably benign Het
Ccdc154 T G 17: 25,170,155 D442E probably benign Het
Col24a1 A G 3: 145,314,037 I60V probably null Het
Crb1 A T 1: 139,237,148 N1140K probably benign Het
Ddhd1 G A 14: 45,608,973 P621S probably benign Het
Ddx46 A T 13: 55,666,220 N663I probably benign Het
Dgki C T 6: 37,034,717 probably benign Het
Disp2 T C 2: 118,790,758 F657S probably damaging Het
Dnajc2 T C 5: 21,768,672 E262G probably damaging Het
Dvl2 T A 11: 70,007,935 L408Q possibly damaging Het
Egflam T C 15: 7,237,768 D712G probably damaging Het
Entpd7 A G 19: 43,704,407 probably benign Het
Epb41 A T 4: 131,967,793 W28R Het
Fabp9 C T 3: 10,197,171 probably benign Het
Fkbp15 T A 4: 62,314,365 M657L probably benign Het
Gfy A C 7: 45,178,360 L104R possibly damaging Het
Gm13103 T C 4: 143,846,570 probably null Het
Gm4070 T C 7: 105,901,913 K644R probably benign Het
Gm4884 A T 7: 41,044,487 I627F probably damaging Het
Gm9195 A T 14: 72,453,880 S1643T unknown Het
Gpsm2 C T 3: 108,703,019 A42T possibly damaging Het
Gys2 T C 6: 142,456,387 Y242C probably damaging Het
Hbs1l A G 10: 21,309,969 N430S probably damaging Het
Idh3b A T 2: 130,284,084 probably benign Het
Igdcc3 C T 9: 65,181,268 A384V probably benign Het
Ighv3-4 C T 12: 114,253,915 D19N possibly damaging Het
Igkv19-93 G T 6: 68,736,510 A45E probably damaging Het
Il10ra G A 9: 45,264,333 T230M probably damaging Het
Kalrn A G 16: 34,217,935 V1009A probably damaging Het
Kcnma1 G T 14: 23,367,650 A837D probably damaging Het
Kif7 T A 7: 79,698,902 R1231S probably benign Het
Klhdc1 A G 12: 69,252,043 D134G possibly damaging Het
Klk14 T C 7: 43,694,035 V97A probably damaging Het
Lamb3 G A 1: 193,321,055 V101M possibly damaging Het
Lrrc7 C T 3: 158,161,744 E787K probably damaging Het
Mep1a A G 17: 43,497,917 I94T possibly damaging Het
Ncr1 C T 7: 4,338,337 S109L probably benign Het
Nell2 A T 15: 95,231,448 M678K probably damaging Het
Olfr165 A T 16: 19,407,646 Y123* probably null Het
Olfr27 T A 9: 39,144,603 F168I probably damaging Het
Olfr296-ps1 G A 7: 86,562,341 C203Y unknown Het
Olfr536 C A 7: 140,504,259 A67S probably benign Het
Pnpla1 A C 17: 28,879,464 Y248S probably damaging Het
Prdm10 T C 9: 31,353,446 F726L probably damaging Het
Prdm16 T C 4: 154,528,913 N19S probably damaging Het
Prss44 A G 9: 110,814,195 R53G probably benign Het
Rasgrp1 C T 2: 117,284,944 R721Q probably benign Het
Rassf1 A T 9: 107,557,541 N149I probably damaging Het
Rbp3 A C 14: 33,956,839 T915P probably benign Het
Reg3g A T 6: 78,467,805 D63E probably benign Het
Rgs3 C A 4: 62,625,136 T236K probably damaging Het
Rin2 T C 2: 145,848,852 F147L probably damaging Het
Skiv2l2 T A 13: 112,914,500 K180N probably benign Het
Slc17a1 T C 13: 23,878,749 I266T probably benign Het
Slc34a3 A T 2: 25,229,255 N534K probably benign Het
Smc2 A T 4: 52,462,856 E615D probably benign Het
Snx16 A C 3: 10,419,133 D343E probably benign Het
Svep1 C T 4: 58,064,204 V3260I possibly damaging Het
Synm C T 7: 67,736,708 R402H possibly damaging Het
Tacc2 A T 7: 130,716,834 E67V possibly damaging Het
Tarbp1 G T 8: 126,471,305 N302K probably damaging Het
Tenm2 A G 11: 36,051,961 S1294P probably damaging Het
Ttk T C 9: 83,869,251 S794P probably damaging Het
Ulk1 G A 5: 110,786,422 A999V probably damaging Het
Upf2 A G 2: 6,026,172 I808V unknown Het
Ush2a A G 1: 188,728,536 T2665A probably benign Het
Usp8 A G 2: 126,748,309 K672E probably damaging Het
Vmn2r105 T A 17: 20,208,967 I616F probably damaging Het
Vps33a T C 5: 123,569,443 M154V probably damaging Het
Wdfy4 A C 14: 33,073,535 Y2083* probably null Het
Zc3hav1 A G 6: 38,311,277 F875L probably benign Het
Zfp979 T C 4: 147,613,379 N291S probably benign Het
Zp2 T A 7: 120,143,612 Y99F possibly damaging Het
Other mutations in St18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:St18 APN 1 6802572 missense probably benign 0.07
IGL00840:St18 APN 1 6833594 missense probably damaging 1.00
IGL01016:St18 APN 1 6844323 missense probably damaging 0.98
IGL01116:St18 APN 1 6802632 missense probably damaging 0.96
IGL01719:St18 APN 1 6845796 splice site probably benign
IGL01885:St18 APN 1 6844372 critical splice donor site probably null
IGL02486:St18 APN 1 6820083 missense probably damaging 1.00
IGL02611:St18 APN 1 6768890 splice site probably benign
IGL02742:St18 APN 1 6802316 splice site probably benign
IGL02953:St18 APN 1 6844113 splice site probably benign
IGL02999:St18 APN 1 6817605 missense probably benign 0.01
IGL03092:St18 APN 1 6768894 splice site probably benign
Smallish UTSW 1 6855473 critical splice donor site probably null
IGL03055:St18 UTSW 1 6802735 missense probably damaging 0.99
R0089:St18 UTSW 1 6848948 missense probably benign 0.02
R0257:St18 UTSW 1 6819962 missense probably benign 0.04
R0383:St18 UTSW 1 6803024 missense probably damaging 1.00
R0588:St18 UTSW 1 6817738 missense probably damaging 0.99
R0989:St18 UTSW 1 6827881 missense probably benign 0.04
R1068:St18 UTSW 1 6795562 missense probably benign 0.01
R1311:St18 UTSW 1 6845644 missense probably damaging 1.00
R1530:St18 UTSW 1 6845569 critical splice acceptor site probably null
R1723:St18 UTSW 1 6810685 splice site probably benign
R1926:St18 UTSW 1 6802689 missense probably benign 0.00
R1927:St18 UTSW 1 6802712 missense probably benign 0.00
R2035:St18 UTSW 1 6802328 missense probably benign 0.00
R2091:St18 UTSW 1 6827971 missense probably benign 0.08
R2139:St18 UTSW 1 6810615 missense possibly damaging 0.85
R2261:St18 UTSW 1 6845572 missense probably damaging 0.96
R2300:St18 UTSW 1 6855402 missense probably damaging 1.00
R2322:St18 UTSW 1 6844124 nonsense probably null
R2846:St18 UTSW 1 6845587 missense probably damaging 0.96
R3738:St18 UTSW 1 6855473 critical splice donor site probably null
R3739:St18 UTSW 1 6855473 critical splice donor site probably null
R3772:St18 UTSW 1 6844329 missense probably damaging 1.00
R3805:St18 UTSW 1 6802353 missense probably damaging 1.00
R3953:St18 UTSW 1 6802893 missense probably damaging 0.99
R4034:St18 UTSW 1 6855473 critical splice donor site probably null
R4036:St18 UTSW 1 6827786 missense probably damaging 1.00
R4407:St18 UTSW 1 6827837 missense probably benign 0.29
R4527:St18 UTSW 1 6855423 missense probably damaging 1.00
R4740:St18 UTSW 1 6817604 missense probably benign
R4838:St18 UTSW 1 6802905 missense probably benign 0.01
R5182:St18 UTSW 1 6817653 missense probably benign 0.03
R5186:St18 UTSW 1 6802317 splice site probably null
R5354:St18 UTSW 1 6844171 missense probably damaging 1.00
R5423:St18 UTSW 1 6802616 missense possibly damaging 0.91
R5724:St18 UTSW 1 6770950 missense probably benign 0.13
R6182:St18 UTSW 1 6844118 splice site probably null
R6491:St18 UTSW 1 6827985 nonsense probably null
R6503:St18 UTSW 1 6795397 missense probably damaging 1.00
R7037:St18 UTSW 1 6803036 missense possibly damaging 0.65
R7098:St18 UTSW 1 6827842 missense probably damaging 1.00
R7132:St18 UTSW 1 6859127 missense
R7144:St18 UTSW 1 6833594 missense probably damaging 1.00
R7150:St18 UTSW 1 6803019 missense probably damaging 1.00
R7334:St18 UTSW 1 6802559 missense probably benign 0.00
R7502:St18 UTSW 1 6827970 missense probably benign 0.09
R7729:St18 UTSW 1 6802537 missense probably benign 0.00
R7848:St18 UTSW 1 6857445 critical splice donor site probably null
R8088:St18 UTSW 1 6828005 missense probably benign 0.00
R8299:St18 UTSW 1 6802992 missense probably benign 0.01
R8338:St18 UTSW 1 6809292 missense probably damaging 1.00
R8690:St18 UTSW 1 6802564 missense probably benign
R8753:St18 UTSW 1 6845791 missense probably damaging 1.00
R8808:St18 UTSW 1 6810602 missense probably damaging 1.00
R9055:St18 UTSW 1 6802982 nonsense probably null
R9292:St18 UTSW 1 6827882 missense probably benign 0.32
R9322:St18 UTSW 1 6795523 missense probably benign 0.00
R9530:St18 UTSW 1 6802773 missense probably benign 0.00
R9603:St18 UTSW 1 6845587 missense probably damaging 1.00
R9611:St18 UTSW 1 6802923 missense probably benign 0.00
R9639:St18 UTSW 1 6859022 missense
R9644:St18 UTSW 1 6859052 missense
R9740:St18 UTSW 1 6803063 nonsense probably null
R9750:St18 UTSW 1 6802992 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TACCCGGGAGTAATGGTGAG -3'
(R):5'- GCTTGGACCATGCCTTTTG -3'

Sequencing Primer
(F):5'- TGAGTTTTTAAATACTTCTGGTGGAC -3'
(R):5'- GGACCATGCCTTTTGCTACCTG -3'
Posted On 2021-07-15