Incidental Mutation 'R8880:Snx16'
ID676819
Institutional Source Beutler Lab
Gene Symbol Snx16
Ensembl Gene ENSMUSG00000027534
Gene Namesorting nexin 16
Synonyms4930522N22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R8880 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location10417817-10440102 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 10419133 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 343 (D343E)
Ref Sequence ENSEMBL: ENSMUSP00000029047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029047] [ENSMUST00000099223] [ENSMUST00000191826] [ENSMUST00000195822]
Predicted Effect probably benign
Transcript: ENSMUST00000029047
AA Change: D343E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000029047
Gene: ENSMUSG00000027534
AA Change: D343E

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
PX 110 214 1.65e-17 SMART
coiled coil region 230 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099223
AA Change: D303E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000096828
Gene: ENSMUSG00000027534
AA Change: D303E

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
PX 110 214 1.65e-17 SMART
coiled coil region 230 274 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191826
SMART Domains Protein: ENSMUSP00000141606
Gene: ENSMUSG00000027536

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
PDB:4ABM|D 29 64 3e-10 PDB
Predicted Effect unknown
Transcript: ENSMUST00000195822
AA Change: D201E
SMART Domains Protein: ENSMUSP00000141230
Gene: ENSMUSG00000027534
AA Change: D201E

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
Blast:PX 105 134 2e-6 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. The protein encoded by this gene associates with late endosome membranes as is involved in tubule formation, cholesterol transport, and transport of tetraspanin CD81. The encoded protein also inhibits cell migration and tumorigenesis. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,664,495 Y130H probably damaging Het
3425401B19Rik C T 14: 32,660,880 V1043I probably benign Het
5031439G07Rik T A 15: 84,955,666 I176F possibly damaging Het
Adam6b T A 12: 113,491,144 M527K probably benign Het
Atp10b C T 11: 43,215,984 T615I probably benign Het
Atxn2 A G 5: 121,810,910 T1117A probably benign Het
Bcam C T 7: 19,758,746 V505M probably damaging Het
Bco2 A T 9: 50,550,662 L14Q probably damaging Het
Cblb T C 16: 52,166,005 V537A probably benign Het
Ccdc141 A T 2: 77,015,212 N1170K probably benign Het
Ccdc154 T G 17: 25,170,155 D442E probably benign Het
Col24a1 A G 3: 145,314,037 I60V probably null Het
Crb1 A T 1: 139,237,148 N1140K probably benign Het
Ddhd1 G A 14: 45,608,973 P621S probably benign Het
Ddx46 A T 13: 55,666,220 N663I probably benign Het
Disp2 T C 2: 118,790,758 F657S probably damaging Het
Dnajc2 T C 5: 21,768,672 E262G probably damaging Het
Dvl2 T A 11: 70,007,935 L408Q possibly damaging Het
Egflam T C 15: 7,237,768 D712G probably damaging Het
Epb41 A T 4: 131,967,793 W28R Het
Fabp9 C T 3: 10,197,171 probably benign Het
Fkbp15 T A 4: 62,314,365 M657L probably benign Het
Gfy A C 7: 45,178,360 L104R possibly damaging Het
Gm13103 T C 4: 143,846,570 probably null Het
Gm4070 T C 7: 105,901,913 K644R probably benign Het
Gm4884 A T 7: 41,044,487 I627F probably damaging Het
Gm9195 A T 14: 72,453,880 S1643T unknown Het
Gpsm2 C T 3: 108,703,019 A42T possibly damaging Het
Gys2 T C 6: 142,456,387 Y242C probably damaging Het
Hbs1l A G 10: 21,309,969 N430S probably damaging Het
Igdcc3 C T 9: 65,181,268 A384V probably benign Het
Ighv3-4 C T 12: 114,253,915 D19N possibly damaging Het
Igkv19-93 G T 6: 68,736,510 A45E probably damaging Het
Il10ra G A 9: 45,264,333 T230M probably damaging Het
Kalrn A G 16: 34,217,935 V1009A probably damaging Het
Kcnma1 G T 14: 23,367,650 A837D probably damaging Het
Kif7 T A 7: 79,698,902 R1231S probably benign Het
Klhdc1 A G 12: 69,252,043 D134G possibly damaging Het
Klk14 T C 7: 43,694,035 V97A probably damaging Het
Lamb3 G A 1: 193,321,055 V101M possibly damaging Het
Lrrc7 C T 3: 158,161,744 E787K probably damaging Het
Mep1a A G 17: 43,497,917 I94T possibly damaging Het
Ncr1 C T 7: 4,338,337 S109L probably benign Het
Nell2 A T 15: 95,231,448 M678K probably damaging Het
Olfr165 A T 16: 19,407,646 Y123* probably null Het
Olfr27 T A 9: 39,144,603 F168I probably damaging Het
Olfr296-ps1 G A 7: 86,562,341 C203Y unknown Het
Olfr536 C A 7: 140,504,259 A67S probably benign Het
Pnpla1 A C 17: 28,879,464 Y248S probably damaging Het
Prdm10 T C 9: 31,353,446 F726L probably damaging Het
Prdm16 T C 4: 154,528,913 N19S probably damaging Het
Prss44 A G 9: 110,814,195 R53G probably benign Het
Rasgrp1 C T 2: 117,284,944 R721Q probably benign Het
Rassf1 A T 9: 107,557,541 N149I probably damaging Het
Rbp3 A C 14: 33,956,839 T915P probably benign Het
Reg3g A T 6: 78,467,805 D63E probably benign Het
Rgs3 C A 4: 62,625,136 T236K probably damaging Het
Rin2 T C 2: 145,848,852 F147L probably damaging Het
Skiv2l2 T A 13: 112,914,500 K180N probably benign Het
Slc17a1 T C 13: 23,878,749 I266T probably benign Het
Slc34a3 A T 2: 25,229,255 N534K probably benign Het
Smc2 A T 4: 52,462,856 E615D probably benign Het
St18 T A 1: 6,795,395 Y32* probably null Het
Svep1 C T 4: 58,064,204 V3260I possibly damaging Het
Synm C T 7: 67,736,708 R402H possibly damaging Het
Tacc2 A T 7: 130,716,834 E67V possibly damaging Het
Tarbp1 G T 8: 126,471,305 N302K probably damaging Het
Tenm2 A G 11: 36,051,961 S1294P probably damaging Het
Ttk T C 9: 83,869,251 S794P probably damaging Het
Ulk1 G A 5: 110,786,422 A999V probably damaging Het
Upf2 A G 2: 6,026,172 I808V unknown Het
Ush2a A G 1: 188,728,536 T2665A probably benign Het
Usp8 A G 2: 126,748,309 K672E probably damaging Het
Vmn2r105 T A 17: 20,208,967 I616F probably damaging Het
Vps33a T C 5: 123,569,443 M154V probably damaging Het
Wdfy4 A C 14: 33,073,535 Y2083* probably null Het
Zc3hav1 A G 6: 38,311,277 F875L probably benign Het
Zfp979 T C 4: 147,613,379 N291S probably benign Het
Zp2 T A 7: 120,143,612 Y99F possibly damaging Het
Other mutations in Snx16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Snx16 APN 3 10419159 missense probably damaging 1.00
IGL02682:Snx16 APN 3 10438175 missense probably damaging 1.00
R0539:Snx16 UTSW 3 10426218 missense probably damaging 0.98
R1469:Snx16 UTSW 3 10434371 missense probably damaging 1.00
R1469:Snx16 UTSW 3 10434371 missense probably damaging 1.00
R1771:Snx16 UTSW 3 10419161 missense probably damaging 1.00
R5262:Snx16 UTSW 3 10437832 missense probably damaging 1.00
R5693:Snx16 UTSW 3 10420258 missense probably benign 0.00
R5964:Snx16 UTSW 3 10434481 missense possibly damaging 0.92
R5969:Snx16 UTSW 3 10438157 missense possibly damaging 0.93
R6826:Snx16 UTSW 3 10438088 missense probably damaging 0.99
R7456:Snx16 UTSW 3 10435481 nonsense probably null
R7996:Snx16 UTSW 3 10435449 missense probably benign 0.11
R8095:Snx16 UTSW 3 10438184 start codon destroyed probably null 1.00
Z1177:Snx16 UTSW 3 10420858 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCCTGATAACAATTCTAACTGGG -3'
(R):5'- TTGACCTCTGATCACCATGAG -3'

Sequencing Primer
(F):5'- AATGCTGGATAAAAGACATTGAAAGC -3'
(R):5'- GACCTCTGATCACCATGAGTATGTAC -3'
Posted On2021-07-15