Incidental Mutation 'R8880:Col24a1'
ID 676821
Institutional Source Beutler Lab
Gene Symbol Col24a1
Ensembl Gene ENSMUSG00000028197
Gene Name collagen, type XXIV, alpha 1
Synonyms 5430404K19Rik
MMRRC Submission 068748-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8880 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 144998233-145257766 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 145019798 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 60 (I60V)
Ref Sequence ENSEMBL: ENSMUSP00000119736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029848] [ENSMUST00000139001]
AlphaFold Q30D77
Predicted Effect silent
Transcript: ENSMUST00000029848
SMART Domains Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
TSPN 41 230 2.7e-3 SMART
LamG 106 229 8.07e-2 SMART
Pfam:Collagen 506 565 9.6e-10 PFAM
Pfam:Collagen 561 623 3.4e-10 PFAM
Pfam:Collagen 604 678 2.3e-9 PFAM
low complexity region 682 724 N/A INTRINSIC
Pfam:Collagen 772 837 1.3e-10 PFAM
Pfam:Collagen 865 938 6e-9 PFAM
Pfam:Collagen 967 1042 3.1e-8 PFAM
low complexity region 1056 1075 N/A INTRINSIC
Pfam:Collagen 1107 1180 8e-9 PFAM
Pfam:Collagen 1159 1218 4.2e-10 PFAM
Pfam:Collagen 1218 1279 1.8e-10 PFAM
Pfam:Collagen 1270 1334 3.1e-9 PFAM
Pfam:Collagen 1378 1443 1.3e-9 PFAM
Pfam:Collagen 1439 1500 1.8e-9 PFAM
COLFI 1533 1733 9.34e-34 SMART
Predicted Effect probably null
Transcript: ENSMUST00000139001
AA Change: I60V
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik C T 14: 32,382,837 (GRCm39) V1043I probably benign Het
5031439G07Rik T A 15: 84,839,867 (GRCm39) I176F possibly damaging Het
Adam6b T A 12: 113,454,764 (GRCm39) M527K probably benign Het
Atp10b C T 11: 43,106,811 (GRCm39) T615I probably benign Het
Atxn2 A G 5: 121,948,973 (GRCm39) T1117A probably benign Het
AU021092 A T 16: 5,032,585 (GRCm39) probably benign Het
Bcam C T 7: 19,492,671 (GRCm39) V505M probably damaging Het
Bco2 A T 9: 50,461,962 (GRCm39) L14Q probably damaging Het
Caps2 T G 10: 112,030,824 (GRCm39) probably benign Het
Cblb T C 16: 51,986,368 (GRCm39) V537A probably benign Het
Ccdc141 A T 2: 76,845,556 (GRCm39) N1170K probably benign Het
Ccdc154 T G 17: 25,389,129 (GRCm39) D442E probably benign Het
Crb1 A T 1: 139,164,886 (GRCm39) N1140K probably benign Het
Ddhd1 G A 14: 45,846,430 (GRCm39) P621S probably benign Het
Ddx46 A T 13: 55,814,033 (GRCm39) N663I probably benign Het
Dgki C T 6: 37,011,652 (GRCm39) probably benign Het
Disp2 T C 2: 118,621,239 (GRCm39) F657S probably damaging Het
Dnajc2 T C 5: 21,973,670 (GRCm39) E262G probably damaging Het
Dvl2 T A 11: 69,898,761 (GRCm39) L408Q possibly damaging Het
Egflam T C 15: 7,267,249 (GRCm39) D712G probably damaging Het
Entpd7 A G 19: 43,692,846 (GRCm39) probably benign Het
Epb41 A T 4: 131,695,104 (GRCm39) W28R Het
Fabp9 C T 3: 10,262,231 (GRCm39) probably benign Het
Fkbp15 T A 4: 62,232,602 (GRCm39) M657L probably benign Het
Gfy A C 7: 44,827,784 (GRCm39) L104R possibly damaging Het
Gm4884 A T 7: 40,693,911 (GRCm39) I627F probably damaging Het
Gm9195 A T 14: 72,691,320 (GRCm39) S1643T unknown Het
Gpsm2 C T 3: 108,610,335 (GRCm39) A42T possibly damaging Het
Gvin2 T C 7: 105,551,120 (GRCm39) K644R probably benign Het
Gys2 T C 6: 142,402,113 (GRCm39) Y242C probably damaging Het
Hbs1l A G 10: 21,185,868 (GRCm39) N430S probably damaging Het
Idh3b A T 2: 130,126,004 (GRCm39) probably benign Het
Igdcc3 C T 9: 65,088,550 (GRCm39) A384V probably benign Het
Ighv3-4 C T 12: 114,217,535 (GRCm39) D19N possibly damaging Het
Igkv19-93 G T 6: 68,713,494 (GRCm39) A45E probably damaging Het
Il10ra G A 9: 45,175,631 (GRCm39) T230M probably damaging Het
Kalrn A G 16: 34,038,305 (GRCm39) V1009A probably damaging Het
Kcnma1 G T 14: 23,417,718 (GRCm39) A837D probably damaging Het
Kif7 T A 7: 79,348,650 (GRCm39) R1231S probably benign Het
Klhdc1 A G 12: 69,298,817 (GRCm39) D134G possibly damaging Het
Klk14 T C 7: 43,343,459 (GRCm39) V97A probably damaging Het
Lamb3 G A 1: 193,003,363 (GRCm39) V101M possibly damaging Het
Lrrc7 C T 3: 157,867,381 (GRCm39) E787K probably damaging Het
Mep1a A G 17: 43,808,808 (GRCm39) I94T possibly damaging Het
Mtrex T A 13: 113,051,034 (GRCm39) K180N probably benign Het
Ncr1 C T 7: 4,341,336 (GRCm39) S109L probably benign Het
Nell2 A T 15: 95,129,329 (GRCm39) M678K probably damaging Het
Or12j5 C A 7: 140,084,172 (GRCm39) A67S probably benign Het
Or14c42-ps1 G A 7: 86,211,549 (GRCm39) C203Y unknown Het
Or2m13 A T 16: 19,226,396 (GRCm39) Y123* probably null Het
Or8g19 T A 9: 39,055,899 (GRCm39) F168I probably damaging Het
Pnpla1 A C 17: 29,098,438 (GRCm39) Y248S probably damaging Het
Pramel27 T C 4: 143,573,140 (GRCm39) probably null Het
Prdm10 T C 9: 31,264,742 (GRCm39) F726L probably damaging Het
Prdm16 T C 4: 154,613,370 (GRCm39) N19S probably damaging Het
Prss44 A G 9: 110,643,263 (GRCm39) R53G probably benign Het
Rasgrp1 C T 2: 117,115,425 (GRCm39) R721Q probably benign Het
Rassf1 A T 9: 107,434,740 (GRCm39) N149I probably damaging Het
Rbp3 A C 14: 33,678,796 (GRCm39) T915P probably benign Het
Reg3g A T 6: 78,444,788 (GRCm39) D63E probably benign Het
Relch T C 1: 105,592,220 (GRCm39) Y130H probably damaging Het
Rgs3 C A 4: 62,543,373 (GRCm39) T236K probably damaging Het
Rin2 T C 2: 145,690,772 (GRCm39) F147L probably damaging Het
Slc17a1 T C 13: 24,062,732 (GRCm39) I266T probably benign Het
Slc34a3 A T 2: 25,119,267 (GRCm39) N534K probably benign Het
Smc2 A T 4: 52,462,856 (GRCm39) E615D probably benign Het
Snx16 A C 3: 10,484,193 (GRCm39) D343E probably benign Het
St18 T A 1: 6,865,619 (GRCm39) Y32* probably null Het
Svep1 C T 4: 58,064,204 (GRCm39) V3260I possibly damaging Het
Synm C T 7: 67,386,456 (GRCm39) R402H possibly damaging Het
Tacc2 A T 7: 130,318,564 (GRCm39) E67V possibly damaging Het
Tarbp1 G T 8: 127,198,044 (GRCm39) N302K probably damaging Het
Tenm2 A G 11: 35,942,788 (GRCm39) S1294P probably damaging Het
Ttk T C 9: 83,751,304 (GRCm39) S794P probably damaging Het
Ulk1 G A 5: 110,934,288 (GRCm39) A999V probably damaging Het
Upf2 A G 2: 6,030,983 (GRCm39) I808V unknown Het
Ush2a A G 1: 188,460,733 (GRCm39) T2665A probably benign Het
Usp8 A G 2: 126,590,229 (GRCm39) K672E probably damaging Het
Vmn2r105 T A 17: 20,429,229 (GRCm39) I616F probably damaging Het
Vps33a T C 5: 123,707,506 (GRCm39) M154V probably damaging Het
Wdfy4 A C 14: 32,795,492 (GRCm39) Y2083* probably null Het
Zc3hav1 A G 6: 38,288,212 (GRCm39) F875L probably benign Het
Zfp979 T C 4: 147,697,836 (GRCm39) N291S probably benign Het
Zp2 T A 7: 119,742,835 (GRCm39) Y99F possibly damaging Het
Other mutations in Col24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Col24a1 APN 3 145,068,064 (GRCm39) missense probably damaging 1.00
IGL00931:Col24a1 APN 3 145,167,225 (GRCm39) missense probably benign 0.00
IGL01160:Col24a1 APN 3 145,213,468 (GRCm39) missense probably damaging 1.00
IGL01355:Col24a1 APN 3 145,020,637 (GRCm39) missense probably benign 0.07
IGL01409:Col24a1 APN 3 145,244,319 (GRCm39) missense probably benign 0.19
IGL01587:Col24a1 APN 3 145,139,110 (GRCm39) splice site probably null
IGL01666:Col24a1 APN 3 145,050,447 (GRCm39) missense possibly damaging 0.93
IGL01717:Col24a1 APN 3 145,230,018 (GRCm39) splice site probably benign
IGL01721:Col24a1 APN 3 145,244,322 (GRCm39) missense probably benign 0.26
IGL01939:Col24a1 APN 3 145,021,005 (GRCm39) missense probably damaging 1.00
IGL01988:Col24a1 APN 3 145,229,922 (GRCm39) splice site probably null
IGL02002:Col24a1 APN 3 145,062,699 (GRCm39) missense possibly damaging 0.81
IGL02172:Col24a1 APN 3 145,020,723 (GRCm39) missense probably benign 0.34
IGL02552:Col24a1 APN 3 145,179,962 (GRCm39) missense possibly damaging 0.88
IGL02559:Col24a1 APN 3 145,019,934 (GRCm39) missense probably benign
IGL02582:Col24a1 APN 3 145,020,247 (GRCm39) missense probably damaging 1.00
IGL02652:Col24a1 APN 3 145,198,056 (GRCm39) nonsense probably null
IGL02942:Col24a1 APN 3 145,247,420 (GRCm39) missense probably damaging 1.00
IGL03032:Col24a1 APN 3 145,244,458 (GRCm39) critical splice donor site probably null
IGL03108:Col24a1 APN 3 145,029,162 (GRCm39) missense probably damaging 1.00
IGL03310:Col24a1 APN 3 145,019,744 (GRCm39) splice site probably benign
IGL03405:Col24a1 APN 3 145,020,918 (GRCm39) missense possibly damaging 0.73
R0066:Col24a1 UTSW 3 145,250,899 (GRCm39) missense probably damaging 1.00
R0066:Col24a1 UTSW 3 145,250,899 (GRCm39) missense probably damaging 1.00
R0379:Col24a1 UTSW 3 145,229,897 (GRCm39) missense possibly damaging 0.94
R0502:Col24a1 UTSW 3 145,251,071 (GRCm39) splice site probably benign
R0556:Col24a1 UTSW 3 145,020,489 (GRCm39) missense possibly damaging 0.53
R0587:Col24a1 UTSW 3 144,998,906 (GRCm39) missense possibly damaging 0.50
R0617:Col24a1 UTSW 3 145,019,881 (GRCm39) missense probably damaging 1.00
R0831:Col24a1 UTSW 3 145,034,520 (GRCm39) missense probably damaging 1.00
R1455:Col24a1 UTSW 3 145,166,593 (GRCm39) missense probably damaging 1.00
R1664:Col24a1 UTSW 3 145,095,355 (GRCm39) critical splice donor site probably null
R1713:Col24a1 UTSW 3 145,072,624 (GRCm39) nonsense probably null
R1854:Col24a1 UTSW 3 145,164,895 (GRCm39) missense probably damaging 1.00
R1855:Col24a1 UTSW 3 145,164,895 (GRCm39) missense probably damaging 1.00
R1861:Col24a1 UTSW 3 145,243,022 (GRCm39) critical splice donor site probably null
R1969:Col24a1 UTSW 3 145,020,691 (GRCm39) missense probably benign 0.03
R2216:Col24a1 UTSW 3 145,020,742 (GRCm39) missense probably benign 0.34
R2290:Col24a1 UTSW 3 145,218,950 (GRCm39) missense probably damaging 1.00
R3702:Col24a1 UTSW 3 145,043,621 (GRCm39) missense probably benign 0.01
R3772:Col24a1 UTSW 3 145,251,041 (GRCm39) missense probably damaging 1.00
R4086:Col24a1 UTSW 3 145,167,192 (GRCm39) missense probably damaging 1.00
R4236:Col24a1 UTSW 3 145,230,037 (GRCm39) nonsense probably null
R4433:Col24a1 UTSW 3 145,020,144 (GRCm39) missense possibly damaging 0.95
R4688:Col24a1 UTSW 3 145,020,144 (GRCm39) missense probably benign 0.00
R4972:Col24a1 UTSW 3 145,215,439 (GRCm39) missense probably benign 0.42
R5157:Col24a1 UTSW 3 145,051,712 (GRCm39) nonsense probably null
R5216:Col24a1 UTSW 3 145,021,071 (GRCm39) missense possibly damaging 0.85
R5274:Col24a1 UTSW 3 145,190,433 (GRCm39) missense probably benign 0.03
R5334:Col24a1 UTSW 3 145,167,280 (GRCm39) missense possibly damaging 0.91
R5416:Col24a1 UTSW 3 145,020,786 (GRCm39) nonsense probably null
R5473:Col24a1 UTSW 3 145,243,016 (GRCm39) missense probably benign 0.41
R5538:Col24a1 UTSW 3 144,998,882 (GRCm39) missense probably damaging 0.99
R5561:Col24a1 UTSW 3 145,004,588 (GRCm39) missense probably benign 0.26
R5648:Col24a1 UTSW 3 145,064,321 (GRCm39) missense probably benign 0.00
R5920:Col24a1 UTSW 3 145,133,985 (GRCm39) missense probably damaging 1.00
R6111:Col24a1 UTSW 3 145,019,815 (GRCm39) missense probably damaging 0.99
R6151:Col24a1 UTSW 3 145,019,815 (GRCm39) missense probably damaging 0.99
R6701:Col24a1 UTSW 3 145,020,141 (GRCm39) missense probably benign 0.00
R6728:Col24a1 UTSW 3 145,020,957 (GRCm39) missense probably benign
R6734:Col24a1 UTSW 3 145,214,429 (GRCm39) missense probably benign 0.06
R6861:Col24a1 UTSW 3 145,166,589 (GRCm39) missense probably damaging 1.00
R6982:Col24a1 UTSW 3 145,020,807 (GRCm39) nonsense probably null
R7001:Col24a1 UTSW 3 145,004,627 (GRCm39) missense probably benign 0.28
R7148:Col24a1 UTSW 3 145,021,060 (GRCm39) missense probably damaging 1.00
R7293:Col24a1 UTSW 3 145,192,059 (GRCm39) nonsense probably null
R7315:Col24a1 UTSW 3 145,137,625 (GRCm39) missense possibly damaging 0.82
R7358:Col24a1 UTSW 3 144,998,926 (GRCm39) critical splice donor site probably null
R7371:Col24a1 UTSW 3 145,049,459 (GRCm39) missense probably benign 0.06
R7383:Col24a1 UTSW 3 145,004,599 (GRCm39) missense probably benign
R7605:Col24a1 UTSW 3 145,244,442 (GRCm39) missense possibly damaging 0.67
R7650:Col24a1 UTSW 3 145,020,214 (GRCm39) missense probably benign 0.00
R7679:Col24a1 UTSW 3 145,105,110 (GRCm39) missense possibly damaging 0.81
R7701:Col24a1 UTSW 3 145,072,656 (GRCm39) splice site probably null
R7701:Col24a1 UTSW 3 145,020,772 (GRCm39) missense probably benign
R7805:Col24a1 UTSW 3 145,019,901 (GRCm39) missense probably benign 0.02
R7913:Col24a1 UTSW 3 145,137,621 (GRCm39) nonsense probably null
R7921:Col24a1 UTSW 3 145,179,993 (GRCm39) missense probably damaging 1.00
R8056:Col24a1 UTSW 3 145,019,925 (GRCm39) missense possibly damaging 0.73
R8240:Col24a1 UTSW 3 145,213,457 (GRCm39) missense probably benign 0.31
R8294:Col24a1 UTSW 3 145,186,844 (GRCm39) missense probably null 1.00
R8305:Col24a1 UTSW 3 145,179,937 (GRCm39) missense probably benign 0.00
R8430:Col24a1 UTSW 3 145,021,060 (GRCm39) missense probably damaging 1.00
R8708:Col24a1 UTSW 3 145,251,020 (GRCm39) missense probably damaging 0.99
R9056:Col24a1 UTSW 3 145,021,009 (GRCm39) missense probably damaging 0.96
R9461:Col24a1 UTSW 3 145,186,879 (GRCm39) nonsense probably null
R9612:Col24a1 UTSW 3 145,250,960 (GRCm39) missense probably benign 0.32
R9777:Col24a1 UTSW 3 145,021,103 (GRCm39) nonsense probably null
Z1176:Col24a1 UTSW 3 145,048,259 (GRCm39) missense probably damaging 1.00
Z1177:Col24a1 UTSW 3 145,048,260 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTTACCTAGAAATTGCTCATGGG -3'
(R):5'- ACTGCAGTCTGTTGTTATTCCG -3'

Sequencing Primer
(F):5'- ATTGCTCATGGGTAGAACATGC -3'
(R):5'- GTTCACTTTGAATGATTGCAACCC -3'
Posted On 2021-07-15