Incidental Mutation 'R8880:Tarbp1'
ID 676851
Institutional Source Beutler Lab
Gene Symbol Tarbp1
Ensembl Gene ENSMUSG00000090290
Gene Name TAR RNA binding protein 1
Synonyms Gm17296
MMRRC Submission 068748-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8880 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 127152068-127201804 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 127198044 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 302 (N302K)
Ref Sequence ENSEMBL: ENSMUSP00000129815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170518]
AlphaFold E9Q368
Predicted Effect probably damaging
Transcript: ENSMUST00000170518
AA Change: N302K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129815
Gene: ENSMUSG00000090290
AA Change: N302K

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
low complexity region 47 57 N/A INTRINSIC
low complexity region 77 97 N/A INTRINSIC
low complexity region 112 127 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
SCOP:d1gw5a_ 1059 1260 3e-3 SMART
Pfam:SpoU_methylase 1421 1564 2.2e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HIV-1, the causative agent of acquired immunodeficiency syndrome (AIDS), contains an RNA genome that produces a chromosomally integrated DNA during the replicative cycle. Activation of HIV-1 gene expression by the transactivator Tat is dependent on an RNA regulatory element (TAR) located downstream of the transcription initiation site. This element forms a stable stem-loop structure and can be bound by either the protein encoded by this gene or by RNA polymerase II. This protein may act to disengage RNA polymerase II from TAR during transcriptional elongation. Alternatively spliced transcripts of this gene may exist, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik C T 14: 32,382,837 (GRCm39) V1043I probably benign Het
5031439G07Rik T A 15: 84,839,867 (GRCm39) I176F possibly damaging Het
Adam6b T A 12: 113,454,764 (GRCm39) M527K probably benign Het
Atp10b C T 11: 43,106,811 (GRCm39) T615I probably benign Het
Atxn2 A G 5: 121,948,973 (GRCm39) T1117A probably benign Het
AU021092 A T 16: 5,032,585 (GRCm39) probably benign Het
Bcam C T 7: 19,492,671 (GRCm39) V505M probably damaging Het
Bco2 A T 9: 50,461,962 (GRCm39) L14Q probably damaging Het
Caps2 T G 10: 112,030,824 (GRCm39) probably benign Het
Cblb T C 16: 51,986,368 (GRCm39) V537A probably benign Het
Ccdc141 A T 2: 76,845,556 (GRCm39) N1170K probably benign Het
Ccdc154 T G 17: 25,389,129 (GRCm39) D442E probably benign Het
Col24a1 A G 3: 145,019,798 (GRCm39) I60V probably null Het
Crb1 A T 1: 139,164,886 (GRCm39) N1140K probably benign Het
Ddhd1 G A 14: 45,846,430 (GRCm39) P621S probably benign Het
Ddx46 A T 13: 55,814,033 (GRCm39) N663I probably benign Het
Dgki C T 6: 37,011,652 (GRCm39) probably benign Het
Disp2 T C 2: 118,621,239 (GRCm39) F657S probably damaging Het
Dnajc2 T C 5: 21,973,670 (GRCm39) E262G probably damaging Het
Dvl2 T A 11: 69,898,761 (GRCm39) L408Q possibly damaging Het
Egflam T C 15: 7,267,249 (GRCm39) D712G probably damaging Het
Entpd7 A G 19: 43,692,846 (GRCm39) probably benign Het
Epb41 A T 4: 131,695,104 (GRCm39) W28R Het
Fabp9 C T 3: 10,262,231 (GRCm39) probably benign Het
Fkbp15 T A 4: 62,232,602 (GRCm39) M657L probably benign Het
Gfy A C 7: 44,827,784 (GRCm39) L104R possibly damaging Het
Gm4884 A T 7: 40,693,911 (GRCm39) I627F probably damaging Het
Gm9195 A T 14: 72,691,320 (GRCm39) S1643T unknown Het
Gpsm2 C T 3: 108,610,335 (GRCm39) A42T possibly damaging Het
Gvin2 T C 7: 105,551,120 (GRCm39) K644R probably benign Het
Gys2 T C 6: 142,402,113 (GRCm39) Y242C probably damaging Het
Hbs1l A G 10: 21,185,868 (GRCm39) N430S probably damaging Het
Idh3b A T 2: 130,126,004 (GRCm39) probably benign Het
Igdcc3 C T 9: 65,088,550 (GRCm39) A384V probably benign Het
Ighv3-4 C T 12: 114,217,535 (GRCm39) D19N possibly damaging Het
Igkv19-93 G T 6: 68,713,494 (GRCm39) A45E probably damaging Het
Il10ra G A 9: 45,175,631 (GRCm39) T230M probably damaging Het
Kalrn A G 16: 34,038,305 (GRCm39) V1009A probably damaging Het
Kcnma1 G T 14: 23,417,718 (GRCm39) A837D probably damaging Het
Kif7 T A 7: 79,348,650 (GRCm39) R1231S probably benign Het
Klhdc1 A G 12: 69,298,817 (GRCm39) D134G possibly damaging Het
Klk14 T C 7: 43,343,459 (GRCm39) V97A probably damaging Het
Lamb3 G A 1: 193,003,363 (GRCm39) V101M possibly damaging Het
Lrrc7 C T 3: 157,867,381 (GRCm39) E787K probably damaging Het
Mep1a A G 17: 43,808,808 (GRCm39) I94T possibly damaging Het
Mtrex T A 13: 113,051,034 (GRCm39) K180N probably benign Het
Ncr1 C T 7: 4,341,336 (GRCm39) S109L probably benign Het
Nell2 A T 15: 95,129,329 (GRCm39) M678K probably damaging Het
Or12j5 C A 7: 140,084,172 (GRCm39) A67S probably benign Het
Or14c42-ps1 G A 7: 86,211,549 (GRCm39) C203Y unknown Het
Or2m13 A T 16: 19,226,396 (GRCm39) Y123* probably null Het
Or8g19 T A 9: 39,055,899 (GRCm39) F168I probably damaging Het
Pnpla1 A C 17: 29,098,438 (GRCm39) Y248S probably damaging Het
Pramel27 T C 4: 143,573,140 (GRCm39) probably null Het
Prdm10 T C 9: 31,264,742 (GRCm39) F726L probably damaging Het
Prdm16 T C 4: 154,613,370 (GRCm39) N19S probably damaging Het
Prss44 A G 9: 110,643,263 (GRCm39) R53G probably benign Het
Rasgrp1 C T 2: 117,115,425 (GRCm39) R721Q probably benign Het
Rassf1 A T 9: 107,434,740 (GRCm39) N149I probably damaging Het
Rbp3 A C 14: 33,678,796 (GRCm39) T915P probably benign Het
Reg3g A T 6: 78,444,788 (GRCm39) D63E probably benign Het
Relch T C 1: 105,592,220 (GRCm39) Y130H probably damaging Het
Rgs3 C A 4: 62,543,373 (GRCm39) T236K probably damaging Het
Rin2 T C 2: 145,690,772 (GRCm39) F147L probably damaging Het
Slc17a1 T C 13: 24,062,732 (GRCm39) I266T probably benign Het
Slc34a3 A T 2: 25,119,267 (GRCm39) N534K probably benign Het
Smc2 A T 4: 52,462,856 (GRCm39) E615D probably benign Het
Snx16 A C 3: 10,484,193 (GRCm39) D343E probably benign Het
St18 T A 1: 6,865,619 (GRCm39) Y32* probably null Het
Svep1 C T 4: 58,064,204 (GRCm39) V3260I possibly damaging Het
Synm C T 7: 67,386,456 (GRCm39) R402H possibly damaging Het
Tacc2 A T 7: 130,318,564 (GRCm39) E67V possibly damaging Het
Tenm2 A G 11: 35,942,788 (GRCm39) S1294P probably damaging Het
Ttk T C 9: 83,751,304 (GRCm39) S794P probably damaging Het
Ulk1 G A 5: 110,934,288 (GRCm39) A999V probably damaging Het
Upf2 A G 2: 6,030,983 (GRCm39) I808V unknown Het
Ush2a A G 1: 188,460,733 (GRCm39) T2665A probably benign Het
Usp8 A G 2: 126,590,229 (GRCm39) K672E probably damaging Het
Vmn2r105 T A 17: 20,429,229 (GRCm39) I616F probably damaging Het
Vps33a T C 5: 123,707,506 (GRCm39) M154V probably damaging Het
Wdfy4 A C 14: 32,795,492 (GRCm39) Y2083* probably null Het
Zc3hav1 A G 6: 38,288,212 (GRCm39) F875L probably benign Het
Zfp979 T C 4: 147,697,836 (GRCm39) N291S probably benign Het
Zp2 T A 7: 119,742,835 (GRCm39) Y99F possibly damaging Het
Other mutations in Tarbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Tarbp1 APN 8 127,185,900 (GRCm39) missense probably damaging 1.00
IGL01419:Tarbp1 APN 8 127,154,894 (GRCm39) missense probably benign 0.03
IGL01475:Tarbp1 APN 8 127,160,701 (GRCm39) missense probably benign 0.03
IGL01688:Tarbp1 APN 8 127,174,290 (GRCm39) missense probably damaging 1.00
IGL01772:Tarbp1 APN 8 127,173,970 (GRCm39) splice site probably benign
IGL02402:Tarbp1 APN 8 127,177,567 (GRCm39) splice site probably benign
IGL02899:Tarbp1 APN 8 127,180,583 (GRCm39) missense probably damaging 0.96
IGL03006:Tarbp1 APN 8 127,170,881 (GRCm39) missense probably damaging 1.00
IGL03273:Tarbp1 APN 8 127,180,574 (GRCm39) missense probably damaging 1.00
PIT4280001:Tarbp1 UTSW 8 127,157,586 (GRCm39) missense probably damaging 0.96
R0048:Tarbp1 UTSW 8 127,174,269 (GRCm39) missense probably damaging 1.00
R0309:Tarbp1 UTSW 8 127,165,667 (GRCm39) splice site probably benign
R0383:Tarbp1 UTSW 8 127,174,223 (GRCm39) missense probably benign 0.00
R0455:Tarbp1 UTSW 8 127,167,612 (GRCm39) missense probably benign 0.00
R0738:Tarbp1 UTSW 8 127,165,540 (GRCm39) critical splice donor site probably null
R1345:Tarbp1 UTSW 8 127,175,069 (GRCm39) missense probably benign 0.03
R1370:Tarbp1 UTSW 8 127,175,069 (GRCm39) missense probably benign 0.03
R1617:Tarbp1 UTSW 8 127,171,007 (GRCm39) missense possibly damaging 0.47
R1628:Tarbp1 UTSW 8 127,157,599 (GRCm39) missense possibly damaging 0.78
R1702:Tarbp1 UTSW 8 127,154,957 (GRCm39) missense probably damaging 1.00
R1873:Tarbp1 UTSW 8 127,173,786 (GRCm39) missense probably damaging 1.00
R2018:Tarbp1 UTSW 8 127,154,853 (GRCm39) missense probably damaging 1.00
R2019:Tarbp1 UTSW 8 127,154,853 (GRCm39) missense probably damaging 1.00
R2060:Tarbp1 UTSW 8 127,174,333 (GRCm39) splice site probably null
R2877:Tarbp1 UTSW 8 127,154,571 (GRCm39) missense probably damaging 1.00
R3008:Tarbp1 UTSW 8 127,174,160 (GRCm39) missense possibly damaging 0.46
R3875:Tarbp1 UTSW 8 127,165,538 (GRCm39) splice site probably benign
R3905:Tarbp1 UTSW 8 127,154,891 (GRCm39) missense probably damaging 1.00
R3923:Tarbp1 UTSW 8 127,167,510 (GRCm39) missense probably benign 0.00
R4420:Tarbp1 UTSW 8 127,173,819 (GRCm39) missense possibly damaging 0.59
R4570:Tarbp1 UTSW 8 127,178,972 (GRCm39) missense probably benign 0.00
R4610:Tarbp1 UTSW 8 127,201,069 (GRCm39) missense probably damaging 1.00
R4649:Tarbp1 UTSW 8 127,173,934 (GRCm39) missense probably damaging 0.96
R4802:Tarbp1 UTSW 8 127,201,628 (GRCm39) missense possibly damaging 0.75
R4951:Tarbp1 UTSW 8 127,174,184 (GRCm39) missense possibly damaging 0.94
R4953:Tarbp1 UTSW 8 127,174,184 (GRCm39) missense possibly damaging 0.94
R5254:Tarbp1 UTSW 8 127,193,895 (GRCm39) missense probably damaging 0.96
R5255:Tarbp1 UTSW 8 127,155,709 (GRCm39) missense probably benign 0.16
R5638:Tarbp1 UTSW 8 127,177,425 (GRCm39) missense probably damaging 1.00
R5696:Tarbp1 UTSW 8 127,174,079 (GRCm39) missense probably damaging 0.98
R5707:Tarbp1 UTSW 8 127,193,883 (GRCm39) missense probably damaging 1.00
R5896:Tarbp1 UTSW 8 127,179,667 (GRCm39) missense probably benign 0.05
R6087:Tarbp1 UTSW 8 127,155,709 (GRCm39) missense probably benign 0.00
R6117:Tarbp1 UTSW 8 127,154,280 (GRCm39) missense probably benign 0.00
R6132:Tarbp1 UTSW 8 127,161,548 (GRCm39) missense probably benign 0.17
R6168:Tarbp1 UTSW 8 127,175,144 (GRCm39) missense possibly damaging 0.89
R6419:Tarbp1 UTSW 8 127,185,783 (GRCm39) missense possibly damaging 0.95
R6482:Tarbp1 UTSW 8 127,177,434 (GRCm39) missense probably benign 0.01
R6766:Tarbp1 UTSW 8 127,174,139 (GRCm39) missense probably benign 0.41
R6775:Tarbp1 UTSW 8 127,163,568 (GRCm39) missense probably benign 0.16
R6960:Tarbp1 UTSW 8 127,155,778 (GRCm39) missense possibly damaging 0.88
R7054:Tarbp1 UTSW 8 127,201,234 (GRCm39) missense possibly damaging 0.85
R7068:Tarbp1 UTSW 8 127,153,773 (GRCm39) missense probably damaging 1.00
R7454:Tarbp1 UTSW 8 127,184,416 (GRCm39) missense probably benign 0.19
R7519:Tarbp1 UTSW 8 127,160,639 (GRCm39) missense possibly damaging 0.87
R7760:Tarbp1 UTSW 8 127,179,546 (GRCm39) missense not run
R7837:Tarbp1 UTSW 8 127,201,300 (GRCm39) missense probably benign 0.00
R7882:Tarbp1 UTSW 8 127,183,232 (GRCm39) missense probably damaging 1.00
R7982:Tarbp1 UTSW 8 127,171,040 (GRCm39) missense probably damaging 1.00
R8166:Tarbp1 UTSW 8 127,153,867 (GRCm39) missense possibly damaging 0.79
R8517:Tarbp1 UTSW 8 127,170,934 (GRCm39) missense probably benign 0.29
R8838:Tarbp1 UTSW 8 127,177,569 (GRCm39) splice site probably benign
R9061:Tarbp1 UTSW 8 127,173,880 (GRCm39) missense probably damaging 1.00
R9123:Tarbp1 UTSW 8 127,174,202 (GRCm39) missense possibly damaging 0.63
R9125:Tarbp1 UTSW 8 127,174,202 (GRCm39) missense possibly damaging 0.63
R9364:Tarbp1 UTSW 8 127,177,462 (GRCm39) missense probably benign 0.01
R9474:Tarbp1 UTSW 8 127,155,779 (GRCm39) missense probably benign 0.44
R9670:Tarbp1 UTSW 8 127,183,262 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GAGCAATCACATGAATCCACTG -3'
(R):5'- CATGATTGGTGATCGCACTATTTGG -3'

Sequencing Primer
(F):5'- TCACATGAATCCACTGAAAGCATTC -3'
(R):5'- GTGATCGCACTATTTGGTAACATTAG -3'
Posted On 2021-07-15