Incidental Mutation 'R8880:Vmn2r105'
ID676882
Institutional Source Beutler Lab
Gene Symbol Vmn2r105
Ensembl Gene ENSMUSG00000091670
Gene Namevomeronasal 2, receptor 105
SynonymsEG627743
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8880 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location20208230-20234872 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20208967 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 616 (I616F)
Ref Sequence ENSEMBL: ENSMUSP00000129762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167382]
Predicted Effect probably damaging
Transcript: ENSMUST00000167382
AA Change: I616F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129762
Gene: ENSMUSG00000091670
AA Change: I616F

DomainStartEndE-ValueType
Pfam:ANF_receptor 85 469 6.5e-42 PFAM
Pfam:NCD3G 512 565 3.2e-21 PFAM
Pfam:7tm_3 598 833 2.5e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,664,495 Y130H probably damaging Het
3425401B19Rik C T 14: 32,660,880 V1043I probably benign Het
5031439G07Rik T A 15: 84,955,666 I176F possibly damaging Het
Adam6b T A 12: 113,491,144 M527K probably benign Het
Atp10b C T 11: 43,215,984 T615I probably benign Het
Atxn2 A G 5: 121,810,910 T1117A probably benign Het
Bcam C T 7: 19,758,746 V505M probably damaging Het
Bco2 A T 9: 50,550,662 L14Q probably damaging Het
Cblb T C 16: 52,166,005 V537A probably benign Het
Ccdc141 A T 2: 77,015,212 N1170K probably benign Het
Ccdc154 T G 17: 25,170,155 D442E probably benign Het
Col24a1 A G 3: 145,314,037 I60V probably null Het
Crb1 A T 1: 139,237,148 N1140K probably benign Het
Ddhd1 G A 14: 45,608,973 P621S probably benign Het
Ddx46 A T 13: 55,666,220 N663I probably benign Het
Disp2 T C 2: 118,790,758 F657S probably damaging Het
Dnajc2 T C 5: 21,768,672 E262G probably damaging Het
Dvl2 T A 11: 70,007,935 L408Q possibly damaging Het
Egflam T C 15: 7,237,768 D712G probably damaging Het
Epb41 A T 4: 131,967,793 W28R Het
Fabp9 C T 3: 10,197,171 probably benign Het
Fkbp15 T A 4: 62,314,365 M657L probably benign Het
Gfy A C 7: 45,178,360 L104R possibly damaging Het
Gm13103 T C 4: 143,846,570 probably null Het
Gm4070 T C 7: 105,901,913 K644R probably benign Het
Gm4884 A T 7: 41,044,487 I627F probably damaging Het
Gm9195 A T 14: 72,453,880 S1643T unknown Het
Gpsm2 C T 3: 108,703,019 A42T possibly damaging Het
Gys2 T C 6: 142,456,387 Y242C probably damaging Het
Hbs1l A G 10: 21,309,969 N430S probably damaging Het
Igdcc3 C T 9: 65,181,268 A384V probably benign Het
Ighv3-4 C T 12: 114,253,915 D19N possibly damaging Het
Igkv19-93 G T 6: 68,736,510 A45E probably damaging Het
Il10ra G A 9: 45,264,333 T230M probably damaging Het
Kalrn A G 16: 34,217,935 V1009A probably damaging Het
Kcnma1 G T 14: 23,367,650 A837D probably damaging Het
Kif7 T A 7: 79,698,902 R1231S probably benign Het
Klhdc1 A G 12: 69,252,043 D134G possibly damaging Het
Klk14 T C 7: 43,694,035 V97A probably damaging Het
Lamb3 G A 1: 193,321,055 V101M possibly damaging Het
Lrrc7 C T 3: 158,161,744 E787K probably damaging Het
Mep1a A G 17: 43,497,917 I94T possibly damaging Het
Ncr1 C T 7: 4,338,337 S109L probably benign Het
Nell2 A T 15: 95,231,448 M678K probably damaging Het
Olfr165 A T 16: 19,407,646 Y123* probably null Het
Olfr27 T A 9: 39,144,603 F168I probably damaging Het
Olfr296-ps1 G A 7: 86,562,341 C203Y unknown Het
Olfr536 C A 7: 140,504,259 A67S probably benign Het
Pnpla1 A C 17: 28,879,464 Y248S probably damaging Het
Prdm10 T C 9: 31,353,446 F726L probably damaging Het
Prdm16 T C 4: 154,528,913 N19S probably damaging Het
Prss44 A G 9: 110,814,195 R53G probably benign Het
Rasgrp1 C T 2: 117,284,944 R721Q probably benign Het
Rassf1 A T 9: 107,557,541 N149I probably damaging Het
Rbp3 A C 14: 33,956,839 T915P probably benign Het
Reg3g A T 6: 78,467,805 D63E probably benign Het
Rgs3 C A 4: 62,625,136 T236K probably damaging Het
Rin2 T C 2: 145,848,852 F147L probably damaging Het
Skiv2l2 T A 13: 112,914,500 K180N probably benign Het
Slc17a1 T C 13: 23,878,749 I266T probably benign Het
Slc34a3 A T 2: 25,229,255 N534K probably benign Het
Smc2 A T 4: 52,462,856 E615D probably benign Het
Snx16 A C 3: 10,419,133 D343E probably benign Het
St18 T A 1: 6,795,395 Y32* probably null Het
Svep1 C T 4: 58,064,204 V3260I possibly damaging Het
Synm C T 7: 67,736,708 R402H possibly damaging Het
Tacc2 A T 7: 130,716,834 E67V possibly damaging Het
Tarbp1 G T 8: 126,471,305 N302K probably damaging Het
Tenm2 A G 11: 36,051,961 S1294P probably damaging Het
Ttk T C 9: 83,869,251 S794P probably damaging Het
Ulk1 G A 5: 110,786,422 A999V probably damaging Het
Upf2 A G 2: 6,026,172 I808V unknown Het
Ush2a A G 1: 188,728,536 T2665A probably benign Het
Usp8 A G 2: 126,748,309 K672E probably damaging Het
Vps33a T C 5: 123,569,443 M154V probably damaging Het
Wdfy4 A C 14: 33,073,535 Y2083* probably null Het
Zc3hav1 A G 6: 38,311,277 F875L probably benign Het
Zfp979 T C 4: 147,613,379 N291S probably benign Het
Zp2 T A 7: 120,143,612 Y99F possibly damaging Het
Other mutations in Vmn2r105
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Vmn2r105 APN 17 20228555 missense probably benign 0.01
IGL01909:Vmn2r105 APN 17 20224656 missense probably damaging 1.00
IGL01925:Vmn2r105 APN 17 20208711 missense possibly damaging 0.94
IGL02021:Vmn2r105 APN 17 20227895 missense possibly damaging 0.49
IGL02828:Vmn2r105 APN 17 20209083 missense possibly damaging 0.80
IGL02838:Vmn2r105 APN 17 20227585 missense probably damaging 1.00
IGL03343:Vmn2r105 APN 17 20226369 nonsense probably null
R0096:Vmn2r105 UTSW 17 20227479 missense possibly damaging 0.49
R0096:Vmn2r105 UTSW 17 20227479 missense possibly damaging 0.49
R0212:Vmn2r105 UTSW 17 20208565 missense possibly damaging 0.90
R0268:Vmn2r105 UTSW 17 20208676 missense probably benign 0.18
R0271:Vmn2r105 UTSW 17 20234703 missense probably damaging 0.96
R0613:Vmn2r105 UTSW 17 20208316 missense probably damaging 1.00
R0765:Vmn2r105 UTSW 17 20227711 missense probably benign 0.20
R0765:Vmn2r105 UTSW 17 20227857 missense probably damaging 0.98
R1162:Vmn2r105 UTSW 17 20227711 missense probably benign 0.20
R1263:Vmn2r105 UTSW 17 20208322 missense probably damaging 1.00
R1363:Vmn2r105 UTSW 17 20208670 missense probably benign 0.00
R1464:Vmn2r105 UTSW 17 20228742 splice site probably benign
R2029:Vmn2r105 UTSW 17 20224578 missense probably damaging 0.99
R2420:Vmn2r105 UTSW 17 20227835 missense probably benign 0.15
R2421:Vmn2r105 UTSW 17 20227835 missense probably benign 0.15
R2422:Vmn2r105 UTSW 17 20227835 missense probably benign 0.15
R2570:Vmn2r105 UTSW 17 20227323 missense probably damaging 1.00
R3847:Vmn2r105 UTSW 17 20208690 missense possibly damaging 0.85
R3848:Vmn2r105 UTSW 17 20208690 missense possibly damaging 0.85
R4030:Vmn2r105 UTSW 17 20208754 missense probably damaging 0.99
R4275:Vmn2r105 UTSW 17 20228640 missense probably damaging 1.00
R4551:Vmn2r105 UTSW 17 20226351 missense probably benign
R4801:Vmn2r105 UTSW 17 20227294 missense probably benign 0.00
R4802:Vmn2r105 UTSW 17 20227294 missense probably benign 0.00
R4816:Vmn2r105 UTSW 17 20208691 missense probably benign 0.27
R4929:Vmn2r105 UTSW 17 20228018 missense probably benign 0.44
R5022:Vmn2r105 UTSW 17 20208414 missense probably damaging 0.99
R5475:Vmn2r105 UTSW 17 20234782 missense probably benign
R5576:Vmn2r105 UTSW 17 20224574 critical splice donor site probably null
R5795:Vmn2r105 UTSW 17 20228736 missense probably benign 0.00
R5895:Vmn2r105 UTSW 17 20228667 missense probably benign 0.10
R6017:Vmn2r105 UTSW 17 20208627 missense probably damaging 0.97
R6210:Vmn2r105 UTSW 17 20228496 missense probably damaging 1.00
R6491:Vmn2r105 UTSW 17 20227730 nonsense probably null
R6542:Vmn2r105 UTSW 17 20228541 missense probably benign 0.03
R6729:Vmn2r105 UTSW 17 20208343 missense probably damaging 0.99
R7020:Vmn2r105 UTSW 17 20209074 missense probably damaging 1.00
R7033:Vmn2r105 UTSW 17 20208612 missense probably damaging 0.97
R7488:Vmn2r105 UTSW 17 20208783 missense probably damaging 1.00
R7491:Vmn2r105 UTSW 17 20228565 missense probably benign 0.02
R7555:Vmn2r105 UTSW 17 20227675 missense probably damaging 0.98
R7863:Vmn2r105 UTSW 17 20208675 missense probably benign 0.18
R8137:Vmn2r105 UTSW 17 20234704 missense probably benign 0.02
R8166:Vmn2r105 UTSW 17 20208642 missense probably benign 0.07
R8186:Vmn2r105 UTSW 17 20224618 nonsense probably null
R8214:Vmn2r105 UTSW 17 20228513 missense probably benign 0.02
R8497:Vmn2r105 UTSW 17 20234872 start codon destroyed probably null 0.75
R8850:Vmn2r105 UTSW 17 20208610 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATTCTCCCTGGAAAAGTGGC -3'
(R):5'- ATGTATGAAGTGTCCAGACAGTC -3'

Sequencing Primer
(F):5'- GTGGCCTTGAATGCAATAACC -3'
(R):5'- GAAGTGTCCAGACAGTCATTATGC -3'
Posted On2021-07-15