Incidental Mutation 'R8880:Mep1a'
ID 676885
Institutional Source Beutler Lab
Gene Symbol Mep1a
Ensembl Gene ENSMUSG00000023914
Gene Name meprin 1 alpha
Synonyms Mep-1a, meprin A alpha-subunit, Mep1, meprin alpha, Mep-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8880 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 43474324-43502812 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43497917 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 94 (I94T)
Ref Sequence ENSEMBL: ENSMUSP00000024707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024707] [ENSMUST00000117137]
AlphaFold P28825
Predicted Effect possibly damaging
Transcript: ENSMUST00000024707
AA Change: I94T

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000024707
Gene: ENSMUSG00000023914
AA Change: I94T

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
ZnMc 83 222 1.16e-41 SMART
MAM 276 445 5.38e-61 SMART
MATH 445 590 6.9e-17 SMART
EGF 687 724 1.35e-2 SMART
transmembrane domain 727 749 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117137
AA Change: I81T

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113838
Gene: ENSMUSG00000023914
AA Change: I81T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
ZnMc 70 209 1.16e-41 SMART
MAM 263 432 5.38e-61 SMART
MATH 432 577 6.9e-17 SMART
EGF 674 711 1.35e-2 SMART
transmembrane domain 714 736 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased litter size, reduced LPS-induced renal injury and bladder inflammation, and increased susceptibility to sodium dextran sulfate-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,664,495 Y130H probably damaging Het
3425401B19Rik C T 14: 32,660,880 V1043I probably benign Het
5031439G07Rik T A 15: 84,955,666 I176F possibly damaging Het
Adam6b T A 12: 113,491,144 M527K probably benign Het
Atp10b C T 11: 43,215,984 T615I probably benign Het
Atxn2 A G 5: 121,810,910 T1117A probably benign Het
Bcam C T 7: 19,758,746 V505M probably damaging Het
Bco2 A T 9: 50,550,662 L14Q probably damaging Het
Cblb T C 16: 52,166,005 V537A probably benign Het
Ccdc141 A T 2: 77,015,212 N1170K probably benign Het
Ccdc154 T G 17: 25,170,155 D442E probably benign Het
Col24a1 A G 3: 145,314,037 I60V probably null Het
Crb1 A T 1: 139,237,148 N1140K probably benign Het
Ddhd1 G A 14: 45,608,973 P621S probably benign Het
Ddx46 A T 13: 55,666,220 N663I probably benign Het
Disp2 T C 2: 118,790,758 F657S probably damaging Het
Dnajc2 T C 5: 21,768,672 E262G probably damaging Het
Dvl2 T A 11: 70,007,935 L408Q possibly damaging Het
Egflam T C 15: 7,237,768 D712G probably damaging Het
Epb41 A T 4: 131,967,793 W28R Het
Fabp9 C T 3: 10,197,171 probably benign Het
Fkbp15 T A 4: 62,314,365 M657L probably benign Het
Gfy A C 7: 45,178,360 L104R possibly damaging Het
Gm13103 T C 4: 143,846,570 probably null Het
Gm4070 T C 7: 105,901,913 K644R probably benign Het
Gm4884 A T 7: 41,044,487 I627F probably damaging Het
Gm9195 A T 14: 72,453,880 S1643T unknown Het
Gpsm2 C T 3: 108,703,019 A42T possibly damaging Het
Gys2 T C 6: 142,456,387 Y242C probably damaging Het
Hbs1l A G 10: 21,309,969 N430S probably damaging Het
Igdcc3 C T 9: 65,181,268 A384V probably benign Het
Ighv3-4 C T 12: 114,253,915 D19N possibly damaging Het
Igkv19-93 G T 6: 68,736,510 A45E probably damaging Het
Il10ra G A 9: 45,264,333 T230M probably damaging Het
Kalrn A G 16: 34,217,935 V1009A probably damaging Het
Kcnma1 G T 14: 23,367,650 A837D probably damaging Het
Kif7 T A 7: 79,698,902 R1231S probably benign Het
Klhdc1 A G 12: 69,252,043 D134G possibly damaging Het
Klk14 T C 7: 43,694,035 V97A probably damaging Het
Lamb3 G A 1: 193,321,055 V101M possibly damaging Het
Lrrc7 C T 3: 158,161,744 E787K probably damaging Het
Ncr1 C T 7: 4,338,337 S109L probably benign Het
Nell2 A T 15: 95,231,448 M678K probably damaging Het
Olfr165 A T 16: 19,407,646 Y123* probably null Het
Olfr27 T A 9: 39,144,603 F168I probably damaging Het
Olfr296-ps1 G A 7: 86,562,341 C203Y unknown Het
Olfr536 C A 7: 140,504,259 A67S probably benign Het
Pnpla1 A C 17: 28,879,464 Y248S probably damaging Het
Prdm10 T C 9: 31,353,446 F726L probably damaging Het
Prdm16 T C 4: 154,528,913 N19S probably damaging Het
Prss44 A G 9: 110,814,195 R53G probably benign Het
Rasgrp1 C T 2: 117,284,944 R721Q probably benign Het
Rassf1 A T 9: 107,557,541 N149I probably damaging Het
Rbp3 A C 14: 33,956,839 T915P probably benign Het
Reg3g A T 6: 78,467,805 D63E probably benign Het
Rgs3 C A 4: 62,625,136 T236K probably damaging Het
Rin2 T C 2: 145,848,852 F147L probably damaging Het
Skiv2l2 T A 13: 112,914,500 K180N probably benign Het
Slc17a1 T C 13: 23,878,749 I266T probably benign Het
Slc34a3 A T 2: 25,229,255 N534K probably benign Het
Smc2 A T 4: 52,462,856 E615D probably benign Het
Snx16 A C 3: 10,419,133 D343E probably benign Het
St18 T A 1: 6,795,395 Y32* probably null Het
Svep1 C T 4: 58,064,204 V3260I possibly damaging Het
Synm C T 7: 67,736,708 R402H possibly damaging Het
Tacc2 A T 7: 130,716,834 E67V possibly damaging Het
Tarbp1 G T 8: 126,471,305 N302K probably damaging Het
Tenm2 A G 11: 36,051,961 S1294P probably damaging Het
Ttk T C 9: 83,869,251 S794P probably damaging Het
Ulk1 G A 5: 110,786,422 A999V probably damaging Het
Upf2 A G 2: 6,026,172 I808V unknown Het
Ush2a A G 1: 188,728,536 T2665A probably benign Het
Usp8 A G 2: 126,748,309 K672E probably damaging Het
Vmn2r105 T A 17: 20,208,967 I616F probably damaging Het
Vps33a T C 5: 123,569,443 M154V probably damaging Het
Wdfy4 A C 14: 33,073,535 Y2083* probably null Het
Zc3hav1 A G 6: 38,311,277 F875L probably benign Het
Zfp979 T C 4: 147,613,379 N291S probably benign Het
Zp2 T A 7: 120,143,612 Y99F possibly damaging Het
Other mutations in Mep1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Mep1a APN 17 43479084 missense probably benign 0.00
IGL02814:Mep1a APN 17 43477221 missense probably benign
IGL03000:Mep1a APN 17 43474990 missense probably benign
IGL03335:Mep1a APN 17 43477173 missense possibly damaging 0.63
IGL03410:Mep1a APN 17 43478095 splice site probably null
PIT4544001:Mep1a UTSW 17 43482287 missense probably damaging 1.00
R0127:Mep1a UTSW 17 43497886 splice site probably benign
R0306:Mep1a UTSW 17 43502643 splice site probably benign
R0329:Mep1a UTSW 17 43497898 critical splice donor site probably null
R0330:Mep1a UTSW 17 43497898 critical splice donor site probably null
R0358:Mep1a UTSW 17 43478950 missense possibly damaging 0.92
R0667:Mep1a UTSW 17 43478190 missense probably benign 0.06
R1101:Mep1a UTSW 17 43491693 missense probably benign 0.03
R1458:Mep1a UTSW 17 43491672 missense probably damaging 1.00
R1525:Mep1a UTSW 17 43491636 missense probably damaging 1.00
R1992:Mep1a UTSW 17 43502682 missense probably benign
R2014:Mep1a UTSW 17 43497906 missense probably benign 0.01
R2212:Mep1a UTSW 17 43477263 missense probably benign 0.02
R3946:Mep1a UTSW 17 43475041 nonsense probably null
R4400:Mep1a UTSW 17 43475006 missense possibly damaging 0.77
R4598:Mep1a UTSW 17 43491578 critical splice donor site probably null
R4616:Mep1a UTSW 17 43486241 missense possibly damaging 0.81
R4688:Mep1a UTSW 17 43482248 missense possibly damaging 0.89
R5085:Mep1a UTSW 17 43478144 missense probably damaging 0.99
R5355:Mep1a UTSW 17 43477146 missense probably damaging 0.98
R5832:Mep1a UTSW 17 43478164 missense probably benign 0.27
R5833:Mep1a UTSW 17 43478164 missense probably benign 0.27
R5834:Mep1a UTSW 17 43478164 missense probably benign 0.27
R5835:Mep1a UTSW 17 43478164 missense probably benign 0.27
R6280:Mep1a UTSW 17 43502392 missense probably damaging 1.00
R6340:Mep1a UTSW 17 43479058 missense probably benign 0.00
R6340:Mep1a UTSW 17 43479233 missense probably benign 0.00
R6934:Mep1a UTSW 17 43482230 missense probably damaging 0.99
R7247:Mep1a UTSW 17 43475104 missense possibly damaging 0.67
R7660:Mep1a UTSW 17 43478977 missense probably benign 0.29
R7685:Mep1a UTSW 17 43479174 missense probably benign 0.00
R7703:Mep1a UTSW 17 43478106 missense possibly damaging 0.69
R7871:Mep1a UTSW 17 43479235 missense probably benign 0.33
R8131:Mep1a UTSW 17 43502667 missense probably benign 0.00
R8783:Mep1a UTSW 17 43478190 missense probably benign 0.00
RF010:Mep1a UTSW 17 43486235 missense probably damaging 0.99
Z1088:Mep1a UTSW 17 43491596 missense probably damaging 1.00
Z1176:Mep1a UTSW 17 43477320 missense probably benign 0.08
Z1177:Mep1a UTSW 17 43486297 missense probably damaging 1.00
Z1177:Mep1a UTSW 17 43486306 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGACACTTTGGCAGGCTGTC -3'
(R):5'- ATTGAGATCTAGAAACCAGGACTG -3'

Sequencing Primer
(F):5'- CTGTCAAAGAAAAACATGTCGTGAC -3'
(R):5'- GTGAAGATCTTATGCCCCAGTACAG -3'
Posted On 2021-07-15